| Variant ID: vg0113553622 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13553622 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTTCACTTGGCGGAAGAGTGGATCAGTCATTTGAGCTGGTATGGATGGCAACAGATGAACTAGACAACATCTATGGACGGTCCGTGGGTTAGAGGCGTT[C/T]
AATATATAAAAGATGGTAACCAGGAAGGCTCCTGAGTGGTCGTGGGGCTAAGGTCGCCAGCAGCATGGATTTGATCCCAAGGGATGGCACCTAGTGGAAT
ATTCCACTAGGTGCCATCCCTTGGGATCAAATCCATGCTGCTGGCGACCTTAGCCCCACGACCACTCAGGAGCCTTCCTGGTTACCATCTTTTATATATT[G/A]
AACGCCTCTAACCCACGGACCGTCCATAGATGTTGTCTAGTTCATCTGTTGCCATCCATACCAGCTCAAATGACTGATCCACTCTTCCGCCAAGTGAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 7.10% | 1.04% | 8.97% | NA |
| All Indica | 2759 | 82.70% | 3.90% | 0.29% | 13.16% | NA |
| All Japonica | 1512 | 82.70% | 14.70% | 2.58% | 0.07% | NA |
| Aus | 269 | 93.70% | 0.00% | 0.00% | 6.32% | NA |
| Indica I | 595 | 98.00% | 0.00% | 0.17% | 1.85% | NA |
| Indica II | 465 | 94.80% | 1.90% | 0.00% | 3.23% | NA |
| Indica III | 913 | 66.70% | 8.40% | 0.55% | 24.32% | NA |
| Indica Intermediate | 786 | 82.40% | 2.70% | 0.25% | 14.63% | NA |
| Temperate Japonica | 767 | 94.90% | 1.40% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 66.10% | 33.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 17.80% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 55.20% | 0.00% | 2.08% | 42.71% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113553622 | C -> T | LOC_Os01g24040.1 | downstream_gene_variant ; 4843.0bp to feature; MODIFIER | silent_mutation | Average:62.037; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0113553622 | C -> T | LOC_Os01g24050.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.037; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0113553622 | C -> DEL | N | N | silent_mutation | Average:62.037; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113553622 | NA | 5.09E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113553622 | NA | 3.36E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113553622 | NA | 1.84E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113553622 | 3.93E-06 | 3.93E-06 | mr1711 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113553622 | NA | 1.42E-06 | mr1819 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113553622 | NA | 9.29E-06 | mr1866 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113553622 | NA | 7.84E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |