Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113307140:

Variant ID: vg0113307140 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13307140
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATGTATCATTTAGTTATAGAAATGCTATAATCAACACGATAACATACAAGTGCTATGCATGTTGCATGGATTCTTGCCCCATTATAATCAGTGCATG[C/T]
GGTATAGTAGTCCTCATTGTTTGAACCGATGACTGCGAACTTGAACTTGAATTGCTACCATGCGACACCCATAATTACCTCCATTTAATTTACACATTAC

Reverse complement sequence

GTAATGTGTAAATTAAATGGAGGTAATTATGGGTGTCGCATGGTAGCAATTCAAGTTCAAGTTCGCAGTCATCGGTTCAAACAATGAGGACTACTATACC[G/A]
CATGCACTGATTATAATGGGGCAAGAATCCATGCAACATGCATAGCACTTGTATGTTATCGTGTTGATTATAGCATTTCTATAACTAAATGATACATTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.60% 0.02% 0.00% NA
All Indica  2759 96.60% 3.40% 0.00% 0.00% NA
All Japonica  1512 4.10% 95.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 86.50% 13.50% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113307140 C -> T LOC_Os01g23650.1 upstream_gene_variant ; 2838.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 62.162 N N N N
vg0113307140 C -> T LOC_Os01g23660.1 upstream_gene_variant ; 4633.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 62.162 N N N N
vg0113307140 C -> T LOC_Os01g23640.1 downstream_gene_variant ; 1845.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 62.162 N N N N
vg0113307140 C -> T LOC_Os01g23640.2 downstream_gene_variant ; 3769.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 62.162 N N N N
vg0113307140 C -> T LOC_Os01g23640-LOC_Os01g23650 intergenic_region ; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 62.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113307140 NA 1.36E-83 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.33E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.80E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 9.66E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 5.25E-49 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.30E-67 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.24E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.20E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.48E-36 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 8.69E-52 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 5.53E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 4.46E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 5.23E-97 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.39E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.46E-21 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 7.55E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.04E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 2.56E-91 mr1711_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.93E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 9.97E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.04E-12 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.05E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 6.66E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.05E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113307140 NA 1.67E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251