Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112995841:

Variant ID: vg0112995841 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12995841
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCATTGTCTAGCTGTAGATGGGTGGAACTTAATGTTCTAGACAGTATGATCAACCCTTAATGGGTCTACTGTTGAAACGCTGGTATACAAACAACAAAT[G/A]
GCAGTTTGTCGTAATTAATCGAGGACTCAACATATGGCATTGAAATTGGTGGGGATTGATGGAAATAACATGCTTGGAAACATTGATCATTTCATCAATT

Reverse complement sequence

AATTGATGAAATGATCAATGTTTCCAAGCATGTTATTTCCATCAATCCCCACCAATTTCAATGCCATATGTTGAGTCCTCGATTAATTACGACAAACTGC[C/T]
ATTTGTTGTTTGTATACCAGCGTTTCAACAGTAGACCCATTAAGGGTTGATCATACTGTCTAGAACATTAAGTTCCACCCATCTACAGCTAGACAATGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	3.00%	1.14%	45.34%	NA
All Indica	2759	26.60%	4.70%	1.45%	67.31%	NA
All Japonica	1512	98.80%	0.20%	0.20%	0.79%	NA
Aus	269	15.20%	0.00%	2.60%	82.16%	NA
Indica I	595	23.20%	10.80%	1.85%	64.20%	NA
Indica II	465	15.50%	0.20%	0.86%	83.44%	NA
Indica III	913	36.40%	2.50%	1.10%	60.02%	NA
Indica Intermediate	786	24.30%	5.20%	1.91%	68.58%	NA
Temperate Japonica	767	99.10%	0.00%	0.39%	0.52%	NA
Tropical Japonica	504	98.80%	0.20%	0.00%	0.99%	NA
Japonica Intermediate	241	97.90%	0.80%	0.00%	1.24%	NA
VI/Aromatic	96	58.30%	7.30%	3.12%	31.25%	NA
Intermediate	90	71.10%	2.20%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112995841	G -> A	LOC_Os01g23110.1	upstream_gene_variant ; 3140.0bp to feature; MODIFIER	silent_mutation	Average:9.181; most accessible tissue: Callus, score: 35.222	N	N	N	N
vg0112995841	G -> A	LOC_Os01g23120.1	upstream_gene_variant ; 4566.0bp to feature; MODIFIER	silent_mutation	Average:9.181; most accessible tissue: Callus, score: 35.222	N	N	N	N
vg0112995841	G -> A	LOC_Os01g23090.1	downstream_gene_variant ; 1052.0bp to feature; MODIFIER	silent_mutation	Average:9.181; most accessible tissue: Callus, score: 35.222	N	N	N	N
vg0112995841	G -> A	LOC_Os01g23100.1	downstream_gene_variant ; 860.0bp to feature; MODIFIER	silent_mutation	Average:9.181; most accessible tissue: Callus, score: 35.222	N	N	N	N
vg0112995841	G -> A	LOC_Os01g23090-LOC_Os01g23100	intergenic_region ; MODIFIER	silent_mutation	Average:9.181; most accessible tissue: Callus, score: 35.222	N	N	N	N
vg0112995841	G -> DEL	N	N	silent_mutation	Average:9.181; most accessible tissue: Callus, score: 35.222	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112995841	9.38E-06	1.09E-10	mr1707	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112995841	NA	1.22E-07	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112995841	NA	4.94E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112995841	NA	5.72E-10	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112995841	NA	4.85E-07	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112995841	3.20E-08	3.43E-12	mr1707_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112995841	9.46E-07	1.85E-08	mr1707_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251