Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112795014:

Variant ID: vg0112795014 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12795014
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCACCCCCCTTACAAGAATCTCGTCCCCGAGATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGT[C/T]
TTCTTATAACAAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGATGGAATCTTCTCTTCACCTGACTTGTCCCTG

Reverse complement sequence

CAGGGACAAGTCAGGTGAAGAGAAGATTCCATCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTTGTTATAAGAA[G/A]
ACGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAATCTCGGGGACGAGATTCTTGTAAGGGGGGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.50%	0.30%	4.85%	68.35%	NA
All Indica	2759	1.50%	0.20%	2.17%	96.12%	NA
All Japonica	1512	77.50%	0.10%	8.60%	13.82%	NA
Aus	269	0.00%	2.20%	0.74%	97.03%	NA
Indica I	595	1.00%	0.00%	2.52%	96.47%	NA
Indica II	465	3.20%	0.90%	1.29%	94.62%	NA
Indica III	913	0.70%	0.00%	2.96%	96.39%	NA
Indica Intermediate	786	1.90%	0.10%	1.53%	96.44%	NA
Temperate Japonica	767	74.40%	0.10%	10.69%	14.73%	NA
Tropical Japonica	504	74.60%	0.00%	8.33%	17.06%	NA
Japonica Intermediate	241	93.40%	0.00%	2.49%	4.15%	NA
VI/Aromatic	96	6.20%	0.00%	30.21%	63.54%	NA
Intermediate	90	37.80%	1.10%	8.89%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112795014	C -> T	LOC_Os01g22750.1	upstream_gene_variant ; 3319.0bp to feature; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795014	C -> T	LOC_Os01g22760.1	downstream_gene_variant ; 2181.0bp to feature; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795014	C -> T	LOC_Os01g22750-LOC_Os01g22760	intergenic_region ; MODIFIER	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N
vg0112795014	C -> DEL	N	N	silent_mutation	Average:6.713; most accessible tissue: Callus, score: 17.257	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112795014	4.26E-08	1.74E-22	mr1498	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	8.61E-07	1.98E-21	mr1769	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	4.28E-09	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	9.37E-08	2.08E-17	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	2.75E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	3.14E-16	mr1498_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	6.11E-21	mr1769_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	3.60E-06	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	2.75E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014	NA	3.56E-13	mr1951_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251