| Variant ID: vg0112714249 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12714249 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 68. )
GTGGAGGAGGAGGAGGAGGAGGCACCGAGGAAGGAGGAGGGGGCAATAGTGTGGGAATAAGGATGGATGGGAGCAAGAGTGAGGATAAGGTTGGTTGGGT[T/C]
GGTGTCACGCACAGAAATTCCCGAATAGAATTTCAAGCAGAATGTGCATTAAAATCCCCGTCCAGGACCAGCCGGGGTACACAAACGACAATGTTGACAT
ATGTCAACATTGTCGTTTGTGTACCCCGGCTGGTCCTGGACGGGGATTTTAATGCACATTCTGCTTGAAATTCTATTCGGGAATTTCTGTGCGTGACACC[A/G]
ACCCAACCAACCTTATCCTCACTCTTGCTCCCATCCATCCTTATTCCCACACTATTGCCCCCTCCTCCTTCCTCGGTGCCTCCTCCTCCTCCTCCTCCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.30% | 7.00% | 44.86% | 16.84% | NA |
| All Indica | 2759 | 1.90% | 10.20% | 66.76% | 21.17% | NA |
| All Japonica | 1512 | 87.80% | 0.90% | 4.89% | 6.48% | NA |
| Aus | 269 | 0.70% | 9.70% | 52.79% | 36.80% | NA |
| Indica I | 595 | 1.50% | 6.10% | 53.95% | 38.49% | NA |
| Indica II | 465 | 3.70% | 9.50% | 64.30% | 22.58% | NA |
| Indica III | 913 | 0.30% | 13.50% | 78.75% | 7.45% | NA |
| Indica Intermediate | 786 | 2.90% | 9.90% | 63.99% | 23.16% | NA |
| Temperate Japonica | 767 | 94.50% | 0.40% | 1.69% | 3.39% | NA |
| Tropical Japonica | 504 | 80.20% | 1.20% | 8.33% | 10.32% | NA |
| Japonica Intermediate | 241 | 82.20% | 1.70% | 7.88% | 8.30% | NA |
| VI/Aromatic | 96 | 55.20% | 9.40% | 30.21% | 5.21% | NA |
| Intermediate | 90 | 47.80% | 4.40% | 36.67% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112714249 | T -> DEL | N | N | silent_mutation | Average:76.946; most accessible tissue: Minghui63 young leaf, score: 85.236 | N | N | N | N |
| vg0112714249 | T -> C | LOC_Os01g22600.1 | upstream_gene_variant ; 4441.0bp to feature; MODIFIER | silent_mutation | Average:76.946; most accessible tissue: Minghui63 young leaf, score: 85.236 | N | N | N | N |
| vg0112714249 | T -> C | LOC_Os01g22600-LOC_Os01g22620 | intergenic_region ; MODIFIER | silent_mutation | Average:76.946; most accessible tissue: Minghui63 young leaf, score: 85.236 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112714249 | NA | 9.31E-07 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 1.46E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 4.00E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 2.21E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 2.33E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 7.47E-06 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 1.71E-06 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 2.23E-09 | mr1726 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112714249 | NA | 7.73E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |