Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112709868:

Variant ID: vg0112709868 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 12709868
Reference Allele: T	Alternative Allele: TCGG,G
Primary Allele: TCGG	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAATTTGATGGCGAGAAAATAATAAAAATAAAAAATGATAAAAATAATCGAGAGCGTTGCCTAGTCATCTAGGGGTTGGGAAGTTTCCAGCGTGGTCG[T/TCGG,G]
GGTCGGGGTCGGCGCGGCCCCCGCGCTTGCCTACCTCCCACGACTCGGGGGTGTTTAGATGGGAGTAAAACTTTTTAGCCCATGTCACATCGGATGTTTA

Reverse complement sequence

TAAACATCCGATGTGACATGGGCTAAAAAGTTTTACTCCCATCTAAACACCCCCGAGTCGTGGGAGGTAGGCAAGCGCGGGGGCCGCGCCGACCCCGACC[A/CCGA,C]
CGACCACGCTGGAAACTTCCCAACCCCTAGATGACTAGGCAACGCTCTCGATTATTTTTATCATTTTTTATTTTTATTATTTTCTCGCCATCAAATTTCC

Allele Frequencies:

Populations	Population Size	Frequency of TCGG(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	30.70%	1.95%	0.17%	G: 4.00%
All Indica	2759	90.40%	1.20%	2.32%	0.25%	G: 5.76%
All Japonica	1512	11.10%	87.70%	0.93%	0.07%	G: 0.20%
Aus	269	90.30%	0.70%	1.12%	0.00%	G: 7.81%
Indica I	595	95.60%	0.70%	0.50%	0.00%	G: 3.19%
Indica II	465	88.20%	3.00%	1.29%	0.22%	G: 7.31%
Indica III	913	88.20%	0.20%	3.94%	0.66%	G: 7.01%
Indica Intermediate	786	90.50%	1.80%	2.42%	0.00%	G: 5.34%
Temperate Japonica	767	5.00%	94.50%	0.39%	0.00%	G: 0.13%
Tropical Japonica	504	18.10%	80.00%	1.39%	0.20%	G: 0.40%
Japonica Intermediate	241	16.20%	82.20%	1.66%	0.00%	NA
VI/Aromatic	96	33.30%	54.20%	7.29%	0.00%	G: 5.21%
Intermediate	90	52.20%	42.20%	4.44%	0.00%	G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112709868	T -> G	LOC_Os01g22600.1	upstream_gene_variant ; 60.0bp to feature; MODIFIER	silent_mutation	Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82	N	N	N	N
vg0112709868	T -> G	LOC_Os01g22600-LOC_Os01g22620	intergenic_region ; MODIFIER	silent_mutation	Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82	N	N	N	N
vg0112709868	T -> DEL	N	N	silent_mutation	Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82	N	N	N	N
vg0112709868	T -> TCGG	LOC_Os01g22600.1	upstream_gene_variant ; 61.0bp to feature; MODIFIER	silent_mutation	Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82	N	N	N	N
vg0112709868	T -> TCGG	LOC_Os01g22600-LOC_Os01g22620	intergenic_region ; MODIFIER	silent_mutation	Average:99.481; most accessible tissue: Zhenshan97 flag leaf, score: 99.82	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0112709868	T	G	-0.03	-0.04	-0.05	-0.01	-0.03	-0.02
vg0112709868	T	TCGG	-0.07	-0.05	-0.05	-0.06	-0.04	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112709868	NA	7.59E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	5.88E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	1.83E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	6.28E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	4.44E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	5.57E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	6.77E-27	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	2.86E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	3.64E-11	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112709868	NA	4.39E-06	mr1986	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251