| Variant ID: vg0112321732 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12321732 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 100. )
TTCATATTGTATTTTATATACATGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATATATTCCTATATGGACTATAGACTC[A/G]
TCTTTTAATATTTCTTTTTTTTAATTCTGAATTTTTATTATTTCTAATTGTATTTCTATGTGGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAA
TTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCCACATAGAAATACAATTAGAAATAATAAAAATTCAGAATTAAAAAAAAGAAATATTAAAAGA[T/C]
GAGTCTATAGTCCATATAGGAATATATATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACATGTATATAAAATACAATATGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.20% | 34.30% | 13.80% | 9.75% | NA |
| All Indica | 2759 | 57.60% | 5.80% | 21.02% | 15.59% | NA |
| All Japonica | 1512 | 8.70% | 89.50% | 1.46% | 0.33% | NA |
| Aus | 269 | 79.90% | 1.10% | 11.90% | 7.06% | NA |
| Indica I | 595 | 37.80% | 0.80% | 45.55% | 15.80% | NA |
| Indica II | 465 | 47.50% | 8.40% | 20.65% | 23.44% | NA |
| Indica III | 913 | 72.30% | 7.90% | 8.43% | 11.39% | NA |
| Indica Intermediate | 786 | 61.60% | 5.50% | 17.30% | 15.65% | NA |
| Temperate Japonica | 767 | 2.50% | 97.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 14.70% | 81.30% | 3.17% | 0.79% | NA |
| Japonica Intermediate | 241 | 16.20% | 82.60% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 25.00% | 65.60% | 6.25% | 3.12% | NA |
| Intermediate | 90 | 35.60% | 46.70% | 13.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112321732 | A -> G | LOC_Os01g21960.1 | upstream_gene_variant ; 4754.0bp to feature; MODIFIER | silent_mutation | Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0112321732 | A -> G | LOC_Os01g21950.1 | downstream_gene_variant ; 4471.0bp to feature; MODIFIER | silent_mutation | Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0112321732 | A -> G | LOC_Os01g21950-LOC_Os01g21960 | intergenic_region ; MODIFIER | silent_mutation | Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0112321732 | A -> DEL | N | N | silent_mutation | Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112321732 | 6.25E-07 | 6.25E-07 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | 1.12E-06 | 1.12E-06 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | NA | 1.54E-68 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | NA | 1.76E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | NA | 6.42E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | 7.25E-06 | 4.91E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | 8.22E-07 | 1.05E-08 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | NA | 5.05E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | NA | 1.91E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112321732 | NA | 2.03E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/