Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112115913:

Variant ID: vg0112115913 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12115913
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAAAGTTTAGAGTCCGTATAAAAATACAGTTTACAAATAATTAAATTCAAAATTAAGAAAAA[C/T]
ATGGAAAGAAGAGTTTAAGGTCAATATAAGAATACAATTTAGAAGTAATTGAAATTCAAAACTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCC

Reverse complement sequence

GGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAGTTTTGAATTTCAATTACTTCTAAATTGTATTCTTATATTGACCTTAAACTCTTCTTTCCAT[G/A]
TTTTTCTTAATTTTGAATTTAATTATTTGTAAACTGTATTTTTATACGGACTCTAAACTTTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	10.70%	0.38%	0.04%	NA
All Indica	2759	83.70%	15.70%	0.51%	0.07%	NA
All Japonica	1512	99.50%	0.30%	0.20%	0.00%	NA
Aus	269	75.80%	24.20%	0.00%	0.00%	NA
Indica I	595	97.00%	3.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.40%	0.00%	0.22%	NA
Indica III	913	68.90%	30.10%	0.99%	0.00%	NA
Indica Intermediate	786	82.80%	16.40%	0.64%	0.13%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.20%	0.60%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112115913	C -> T	LOC_Os01g21630.1	upstream_gene_variant ; 1194.0bp to feature; MODIFIER	silent_mutation	Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0112115913	C -> T	LOC_Os01g21620.1	downstream_gene_variant ; 2069.0bp to feature; MODIFIER	silent_mutation	Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0112115913	C -> T	LOC_Os01g21620-LOC_Os01g21630	intergenic_region ; MODIFIER	silent_mutation	Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0112115913	C -> DEL	N	N	silent_mutation	Average:14.104; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112115913	NA	6.16E-06	mr1427	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913	NA	4.30E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913	NA	3.04E-07	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913	NA	1.58E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913	NA	1.20E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112115913	NA	2.63E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251