Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0111315642:

Variant ID: vg0111315642 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 11315642
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.20, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAGAAAAGAAACCCAGCGCAAAGGCTGGGAACATATCTAATCGGACTATAGCGATAACCGCTTCTCGTTCGATAGATCGGTTGTACAAGGGATAACCC[C/T]
ATACGCCTGTCGCGCATGGGGTGGAGAGCCACAAACTCTCCTGCTACGTGCGCCATAAGGGACAAATCCACGTAGTACAACCCATCGATCGAACGATTAG

Reverse complement sequence

CTAATCGTTCGATCGATGGGTTGTACTACGTGGATTTGTCCCTTATGGCGCACGTAGCAGGAGAGTTTGTGGCTCTCCACCCCATGCGCGACAGGCGTAT[G/A]
GGGTTATCCCTTGTACAACCGATCTATCGAACGAGAAGCGGTTATCGCTATAGTCCGATTAGATATGTTCCCAGCCTTTGCGCTGGGTTTCTTTTCTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.30% 0.36% 0.11% NA
All Indica  2759 29.20% 70.10% 0.54% 0.14% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 39.00% 60.60% 0.00% 0.37% NA
Indica I  595 23.90% 74.50% 1.34% 0.34% NA
Indica II  465 33.30% 65.80% 0.65% 0.22% NA
Indica III  913 32.40% 67.40% 0.22% 0.00% NA
Indica Intermediate  786 27.00% 72.60% 0.25% 0.13% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0111315642 C -> T LOC_Os01g19920.1 upstream_gene_variant ; 3791.0bp to feature; MODIFIER silent_mutation Average:75.149; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0111315642 C -> T LOC_Os01g19930.1 upstream_gene_variant ; 1631.0bp to feature; MODIFIER silent_mutation Average:75.149; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0111315642 C -> T LOC_Os01g19940.1 upstream_gene_variant ; 959.0bp to feature; MODIFIER silent_mutation Average:75.149; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0111315642 C -> T LOC_Os01g19930-LOC_Os01g19940 intergenic_region ; MODIFIER silent_mutation Average:75.149; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0111315642 C -> DEL N N silent_mutation Average:75.149; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0111315642 C T -0.09 -0.05 -0.07 -0.02 -0.1 -0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0111315642 NA 7.65E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111315642 NA 7.45E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111315642 NA 3.53E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111315642 7.29E-06 NA mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0111315642 1.37E-07 6.91E-09 mr1364_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251