| Variant ID: vg0110547989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 10547989 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 119. )
AGTGAGACCCAACGCCGTCTCCCGCCTGACACGGGGGACAGTCCTGTCATTCCCTCATAAATGTGTGAAGACTTGTGGCGACCGTCCTTCTCGTAGAGGG[A/G]
GCTCCGAATCATGCTCTGATGGGACGGGTCATACCTACCTCCACTCCGCCGGGAACAAAGGCGACGTGAGGGCATGGTCGCCCGTCCAGTCAGATGCGAC
GTCGCATCTGACTGGACGGGCGACCATGCCCTCACGTCGCCTTTGTTCCCGGCGGAGTGGAGGTAGGTATGACCCGTCCCATCAGAGCATGATTCGGAGC[T/C]
CCCTCTACGAGAAGGACGGTCGCCACAAGTCTTCACACATTTATGAGGGAATGACAGGACTGTCCCCCGTGTCAGGCGGGAGACGGCGTTGGGTCTCACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 23.40% | 0.30% | 0.04% | NA |
| All Indica | 2759 | 60.60% | 38.80% | 0.51% | 0.04% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.80% | 80.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 54.00% | 45.20% | 0.65% | 0.22% | NA |
| Indica III | 913 | 86.60% | 12.70% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 65.30% | 34.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0110547989 | A -> G | LOC_Os01g18690.1 | upstream_gene_variant ; 4271.0bp to feature; MODIFIER | silent_mutation | Average:72.427; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg0110547989 | A -> G | LOC_Os01g18700.1 | upstream_gene_variant ; 841.0bp to feature; MODIFIER | silent_mutation | Average:72.427; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg0110547989 | A -> G | LOC_Os01g18720.1 | upstream_gene_variant ; 3849.0bp to feature; MODIFIER | silent_mutation | Average:72.427; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg0110547989 | A -> G | LOC_Os01g18710.1 | downstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:72.427; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg0110547989 | A -> G | LOC_Os01g18700-LOC_Os01g18710 | intergenic_region ; MODIFIER | silent_mutation | Average:72.427; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| vg0110547989 | A -> DEL | N | N | silent_mutation | Average:72.427; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0110547989 | NA | 8.22E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 8.02E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 1.94E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 1.77E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 8.78E-08 | mr1181 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 3.18E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 3.51E-08 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 3.66E-08 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 6.19E-08 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0110547989 | NA | 5.35E-08 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |