Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0110154128:

Variant ID: vg0110154128 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 10154128
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGCCTCTTCGAGACAGTGCAAATAAAAAGCCTCTTCGAGGAGACCAGTGGTGACAAAATGATTTTTTTAGAAAAGGGTGTTTTTTATCCGGCATGT[G/A]
AAATTTGCTCTTATAGAGATTTGAACTCAGGACTTTGGAGTACTACTCAAGTCACTGCAACCACTGTACTACATGATAATTATGTGTTTTTTATTTCGTA

Reverse complement sequence

TACGAAATAAAAAACACATAATTATCATGTAGTACAGTGGTTGCAGTGACTTGAGTAGTACTCCAAAGTCCTGAGTTCAAATCTCTATAAGAGCAAATTT[C/T]
ACATGCCGGATAAAAAACACCCTTTTCTAAAAAAATCATTTTGTCACCACTGGTCTCCTCGAAGAGGCTTTTTATTTGCACTGTCTCGAAGAGGCTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.30%	3.60%	1.80%	1.31%	NA
All Indica	2759	89.40%	5.60%	2.72%	2.25%	NA
All Japonica	1512	98.60%	1.00%	0.40%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.20%	5.20%	5.55%	0.00%	NA
Indica II	465	95.90%	2.20%	1.08%	0.86%	NA
Indica III	913	88.20%	6.50%	0.55%	4.82%	NA
Indica Intermediate	786	87.20%	7.00%	4.07%	1.78%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	2.80%	0.99%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0110154128	G -> A	LOC_Os01g18130.1	upstream_gene_variant ; 2290.0bp to feature; MODIFIER	silent_mutation	Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg0110154128	G -> A	LOC_Os01g18120.1	downstream_gene_variant ; 1608.0bp to feature; MODIFIER	silent_mutation	Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg0110154128	G -> A	LOC_Os01g18120-LOC_Os01g18130	intergenic_region ; MODIFIER	silent_mutation	Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg0110154128	G -> DEL	N	N	silent_mutation	Average:40.364; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0110154128	9.35E-06	6.01E-09	mr1013	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	NA	3.99E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	NA	5.78E-08	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	NA	8.53E-08	mr1034	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	NA	1.06E-07	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	NA	4.33E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	5.45E-06	NA	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0110154128	NA	2.39E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251