Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107999218:

Variant ID: vg0107999218 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7999218
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TAAACCGCCCTCCCTAAGGGCGGTAAGGGGACCGCCTGCAAAATGGCAGGCCCCCTATAGCCGACCGTTAGGCATAAGCCAACGGTCGTCTGCCACGTCA[C/T]
GAAAAGGCGGCAGGCGACTAGTTTTGTAAATTTTTGAAACACAAATTAGTTTTGTAAATATTTTAATAAAAAATTAAAAATAAAAAAAAAATTGTCCAAC

Reverse complement sequence

GTTGGACAATTTTTTTTTTATTTTTAATTTTTTATTAAAATATTTACAAAACTAATTTGTGTTTCAAAAATTTACAAAACTAGTCGCCTGCCGCCTTTTC[G/A]
TGACGTGGCAGACGACCGTTGGCTTATGCCTAACGGTCGGCTATAGGGGGCCTGCCATTTTGCAGGCGGTCCCCTTACCGCCCTTAGGGAGGGCGGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	21.80%	8.72%	0.00%	NA
All Indica	2759	50.70%	35.70%	13.66%	0.00%	NA
All Japonica	1512	97.50%	1.20%	1.32%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	44.20%	29.70%	26.05%	0.00%	NA
Indica II	465	34.60%	50.10%	15.27%	0.00%	NA
Indica III	913	62.30%	34.00%	3.72%	0.00%	NA
Indica Intermediate	786	51.50%	33.60%	14.89%	0.00%	NA
Temperate Japonica	767	96.90%	2.00%	1.17%	0.00%	NA
Tropical Japonica	504	98.40%	0.40%	1.19%	0.00%	NA
Japonica Intermediate	241	97.50%	0.40%	2.07%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	60.00%	25.60%	14.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107999218	C -> T	LOC_Os01g14260.1	downstream_gene_variant ; 2063.0bp to feature; MODIFIER	silent_mutation	Average:55.241; most accessible tissue: Zhenshan97 flower, score: 66.436	N	N	N	N
vg0107999218	C -> T	LOC_Os01g14280.1	downstream_gene_variant ; 4862.0bp to feature; MODIFIER	silent_mutation	Average:55.241; most accessible tissue: Zhenshan97 flower, score: 66.436	N	N	N	N
vg0107999218	C -> T	LOC_Os01g14270.1	intron_variant ; MODIFIER	silent_mutation	Average:55.241; most accessible tissue: Zhenshan97 flower, score: 66.436	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107999218	NA	1.64E-16	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107999218	NA	1.69E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	1.22E-06	mr1706	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	2.12E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	1.60E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	3.49E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	7.18E-06	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	1.57E-06	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	5.98E-06	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107999218	NA	6.53E-06	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251