Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107648672:

Variant ID: vg0107648672 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7648672
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGGTGTGGGGATGGATTTTATAGGCTCAGGAGACGACGAGGAGCTCGGGTCGGGGTGGCAAAGGCCGGTGGAGAGGGGGCGATGGCGTGGGATGAC[A/G]
GGAGTTGCAACGCTGATTTCCGCGGAGAGAGTGGGAGAAGAGAGCGGGGAAGTGGGGCGACGCGATCCCACGGGCAGGTGACCCGTCGTCGTGGTCCCAA

Reverse complement sequence

TTGGGACCACGACGACGGGTCACCTGCCCGTGGGATCGCGTCGCCCCACTTCCCCGCTCTCTTCTCCCACTCTCTCCGCGGAAATCAGCGTTGCAACTCC[T/C]
GTCATCCCACGCCATCGCCCCCTCTCCACCGGCCTTTGCCACCCCGACCCGAGCTCCTCGTCGTCTCCTGAGCCTATAAAATCCATCCCCACACCTCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 12.60% 0.76% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 59.50% 38.20% 2.25% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 29.70% 66.50% 3.78% 0.00% NA
Tropical Japonica  504 98.00% 1.60% 0.40% 0.00% NA
Japonica Intermediate  241 73.90% 24.90% 1.24% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107648672 A -> G LOC_Os01g13640.1 missense_variant ; p.Arg6Gly; MODERATE nonsynonymous_codon ; R6E Average:76.491; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 unknown unknown DELETERIOUS 0.00
vg0107648672 A -> G LOC_Os01g13640.1 missense_variant ; p.Arg6Gly; MODERATE nonsynonymous_codon ; R6G Average:76.491; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107648672 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107648672 NA 5.66E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107648672 NA 3.02E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107648672 4.29E-06 4.29E-06 mr1172_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107648672 NA 1.02E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107648672 NA 9.56E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107648672 NA 1.22E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107648672 1.04E-06 9.73E-09 mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107648672 NA 5.32E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251