RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0107544024:

Variant ID: vg0107544024 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7544024
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TGATAAATACATCAAAACTTTTTATTGATAGTGAAATTATTGACTGCAAGTTTTTGCCAATAGTGAAATCATCGAAAGTGAAACCATTAGAAGCATTTAT[G/A]
AAATCATCGATAGGGAAAGGTTTGACAATAGTGAAATCATTTACGGTAAGTTTTTACCAAAGAACTTACATAAATGCTATAAGGGAAGAAAAAATGTGGT

Reverse complement sequence

ACCACATTTTTTCTTCCCTTATAGCATTTATGTAAGTTCTTTGGTAAAAACTTACCGTAAATGATTTCACTATTGTCAAACCTTTCCCTATCGATGATTT[C/T]
ATAAATGCTTCTAATGGTTTCACTTTCGATGATTTCACTATTGGCAAAAACTTGCAGTCAATAATTTCACTATCAATAAAAAGTTTTGATGTATTTATCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	3.60%	0.25%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	92.50%	6.80%	0.73%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	82.10%	16.50%	1.39%	0.00%	NA
Japonica Intermediate	241	91.30%	7.90%	0.83%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107544024	G -> A	LOC_Os01g13510.1	missense_variant ; p.Met44Ile; MODERATE	nonsynonymous_codon ; M44I	Average:30.285; most accessible tissue: Callus, score: 55.379	unknown	unknown	DELETERIOUS	0.00

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107544024	1.72E-06	1.72E-06	mr1098	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107544024	NA	6.41E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107544024	7.73E-08	7.73E-08	mr1589	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107544024	NA	1.31E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107544024	NA	1.83E-06	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107544024	NA	6.44E-06	mr1150_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0107544024:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact