Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107103607:

Variant ID: vg0107103607 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7103607
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TCTACCTACAAATCATAAATACTTTTTTAGGTAGGCACGGATATTTAAAAAATAGATAGAGATAATTGAAGGAGGATTGTGATTGGTCGAAAAGATAAAG[T/C]
AGGTAAAGAGAATAGTTGTGATTGGTTGAGAGTAGATGGTAGGTGGAGAAATAGCTTCATTTGGAACAAGTCAATGTGCTAGAAATAACTATATTTTAAA

Reverse complement sequence

TTTAAAATATAGTTATTTCTAGCACATTGACTTGTTCCAAATGAAGCTATTTCTCCACCTACCATCTACTCTCAACCAATCACAACTATTCTCTTTACCT[A/G]
CTTTATCTTTTCGACCAATCACAATCCTCCTTCAATTATCTCTATCTATTTTTTAAATATCCGTGCCTACCTAAAAAAGTATTTATGATTTGTAGGTAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	25.80%	0.44%	0.06%	NA
All Indica	2759	57.30%	42.00%	0.65%	0.11%	NA
All Japonica	1512	98.90%	1.10%	0.07%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	90.30%	9.20%	0.50%	0.00%	NA
Indica II	465	19.10%	80.90%	0.00%	0.00%	NA
Indica III	913	65.20%	33.80%	0.77%	0.22%	NA
Indica Intermediate	786	45.70%	53.20%	1.02%	0.13%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107103607	T -> DEL	N	N	silent_mutation	Average:73.861; most accessible tissue: Minghui63 root, score: 87.745	N	N	N	N
vg0107103607	T -> C	LOC_Os01g12830.1	upstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:73.861; most accessible tissue: Minghui63 root, score: 87.745	N	N	N	N
vg0107103607	T -> C	LOC_Os01g12830.2	upstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:73.861; most accessible tissue: Minghui63 root, score: 87.745	N	N	N	N
vg0107103607	T -> C	LOC_Os01g12840.1	downstream_gene_variant ; 666.0bp to feature; MODIFIER	silent_mutation	Average:73.861; most accessible tissue: Minghui63 root, score: 87.745	N	N	N	N
vg0107103607	T -> C	LOC_Os01g12830-LOC_Os01g12840	intergenic_region ; MODIFIER	silent_mutation	Average:73.861; most accessible tissue: Minghui63 root, score: 87.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107103607	NA	5.79E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	6.33E-07	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	1.45E-06	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	1.30E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	3.52E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	1.11E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	2.84E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	1.62E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	2.93E-07	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	1.23E-07	7.41E-06	mr1699_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	1.62E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107103607	NA	1.45E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251