Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107072026:

Variant ID: vg0107072026 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7072026
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGGCGGCCGCGACGTCGCGTTCGCGCCCTACGGCGAGTACTGGCGCCAGGCGCGCCGCATCTGCGTGGTCCACCTCCTCAGCGCGCGCCGCGTCCTCT[C/T]
GTTCCGCCGCGTCAGGGAGGAGGAGGCCGCCGCGCTCGTCGGCCGCGTCCGCGCCGCCGCCGCCGACGTCGTCGTCGACCTGTCCGACCTCCTCATCGCT

Reverse complement sequence

AGCGATGAGGAGGTCGGACAGGTCGACGACGACGTCGGCGGCGGCGGCGCGGACGCGGCCGACGAGCGCGGCGGCCTCCTCCTCCCTGACGCGGCGGAAC[G/A]
AGAGGACGCGGCGCGCGCTGAGGAGGTGGACCACGCAGATGCGGCGCGCCTGGCGCCAGTACTCGCCGTAGGGCGCGAACGCGACGTCGCGGCCGCCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 19.30% 1.40% 0.38% NA
All Indica  2759 67.40% 32.00% 0.62% 0.00% NA
All Japonica  1512 95.50% 0.30% 3.24% 0.99% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 91.30% 8.40% 0.34% 0.00% NA
Indica II  465 65.40% 34.60% 0.00% 0.00% NA
Indica III  913 58.20% 40.70% 1.10% 0.00% NA
Indica Intermediate  786 61.20% 38.20% 0.64% 0.00% NA
Temperate Japonica  767 92.40% 0.10% 5.87% 1.56% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 0.40% 1.24% 1.24% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 80.00% 18.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107072026 C -> T LOC_Os01g12770.1 missense_variant ; p.Ser163Leu; MODERATE nonsynonymous_codon ; S163L Average:84.545; most accessible tissue: Minghui63 flag leaf, score: 94.633 possibly damaging 1.837 DELETERIOUS 0.01
vg0107072026 C -> DEL LOC_Os01g12770.1 N frameshift_variant Average:84.545; most accessible tissue: Minghui63 flag leaf, score: 94.633 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107072026 C T -0.01 0.0 -0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107072026 NA 5.46E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 NA 9.01E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 8.16E-08 NA mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 4.76E-07 2.95E-08 mr1699 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 NA 1.67E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 2.84E-06 1.39E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 NA 1.96E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 NA 7.06E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 2.74E-11 NA mr1699_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 5.30E-09 1.10E-13 mr1699_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107072026 7.30E-06 NA mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251