Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107036111:

Variant ID: vg0107036111 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7036111
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCCAAAATAAGTTCTTTTTTAAGTAATCATTATATTGAAGTTAGTAAGAAATAGTTGCATTGAGATTTTATAAAGCAGGGGTATTCTAGTTCTTTATT[G/A]
GTATGTGTGAGATATGTAAAAAATAAACTTATTTTGAAACAGAGAGAATATTTGTTATGGTGAATCTCTAAGAGTTTGGAATCTCATTGTATGGAACTAT

Reverse complement sequence

ATAGTTCCATACAATGAGATTCCAAACTCTTAGAGATTCACCATAACAAATATTCTCTCTGTTTCAAAATAAGTTTATTTTTTACATATCTCACACATAC[C/T]
AATAAAGAACTAGAATACCCCTGCTTTATAAAATCTCAATGCAACTATTTCTTACTAACTTCAATATAATGATTACTTAAAAAAGAACTTATTTTGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.80%	26.70%	0.13%	0.34%	NA
All Indica	2759	54.00%	45.30%	0.18%	0.58%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	15.60%	84.00%	0.00%	0.34%	NA
Indica II	465	83.20%	16.80%	0.00%	0.00%	NA
Indica III	913	50.50%	48.40%	0.22%	0.88%	NA
Indica Intermediate	786	69.70%	29.10%	0.38%	0.76%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107036111	G -> A	LOC_Os01g12720.1	upstream_gene_variant ; 1992.0bp to feature; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799	N	N	N	N
vg0107036111	G -> A	LOC_Os01g12710-LOC_Os01g12720	intergenic_region ; MODIFIER	silent_mutation	Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799	N	N	N	N
vg0107036111	G -> DEL	N	N	silent_mutation	Average:66.359; most accessible tissue: Minghui63 flower, score: 84.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107036111	1.65E-06	4.69E-08	mr1518	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	1.76E-06	4.97E-09	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	NA	7.00E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	NA	6.49E-10	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	NA	4.15E-06	mr1821	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	NA	5.66E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	8.30E-07	1.13E-07	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107036111	NA	3.57E-09	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251