Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106959659:

Variant ID: vg0106959659 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6959659
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCATAACTAAGGGCCCCTTTCAAACACAGGATAGGAAAAACACAGGAATAGAAAAAATATAGGAATTGAAGTGGTATGTTTTACTAATCCTACATGAAT[G/A]
AAAAACACAGGAAATATAAAGAGGGTCCCTTTGATAGCACCATAGGAAATAAACAAAGCAAATGATAGTTTCCAAGAGGTTGAACCTCTTGCTTATTTTC

Reverse complement sequence

GAAAATAAGCAAGAGGTTCAACCTCTTGGAAACTATCATTTGCTTTGTTTATTTCCTATGGTGCTATCAAAGGGACCCTCTTTATATTTCCTGTGTTTTT[C/T]
ATTCATGTAGGATTAGTAAAACATACCACTTCAATTCCTATATTTTTTCTATTCCTGTGTTTTTCCTATCCTGTGTTTGAAAGGGGCCCTTAGTTATGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.50% 0.06% 0.00% NA
All Indica  2759 92.50% 7.40% 0.04% 0.00% NA
All Japonica  1512 79.10% 20.80% 0.07% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.30% 0.13% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 44.00% 55.80% 0.20% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106959659 G -> A LOC_Os01g12630.1 upstream_gene_variant ; 4585.0bp to feature; MODIFIER silent_mutation Average:42.026; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0106959659 G -> A LOC_Os01g12640.1 upstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:42.026; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0106959659 G -> A LOC_Os01g12640.2 upstream_gene_variant ; 922.0bp to feature; MODIFIER silent_mutation Average:42.026; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0106959659 G -> A LOC_Os01g12640-LOC_Os01g12650 intergenic_region ; MODIFIER silent_mutation Average:42.026; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106959659 NA 4.67E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 8.31E-06 2.67E-09 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 1.87E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 2.60E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 6.78E-08 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 1.88E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 2.06E-12 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 2.02E-16 4.50E-33 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 1.24E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 9.11E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 1.72E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 3.88E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.41E-15 2.43E-16 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 2.27E-10 7.95E-26 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 6.32E-06 1.18E-21 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 4.47E-09 2.99E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 7.18E-07 7.18E-07 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.84E-09 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 2.01E-09 6.43E-15 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 6.11E-15 1.63E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 4.11E-14 5.33E-24 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 9.02E-12 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 4.08E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 9.14E-06 9.98E-08 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 3.99E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.45E-11 5.27E-17 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 7.77E-21 1.63E-12 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 2.58E-16 6.72E-28 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.92E-09 6.89E-12 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 NA 1.41E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 7.32E-23 5.70E-24 mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 4.57E-16 1.48E-33 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 5.33E-10 7.17E-27 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.28E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.41E-06 8.26E-08 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 1.82E-11 NA mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 6.09E-11 1.88E-14 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 8.14E-13 8.05E-07 mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 3.03E-12 2.34E-20 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959659 2.97E-06 1.92E-07 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251