Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106684036:

Variant ID: vg0106684036 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6684036
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CACGGAGTACTACTCCAGCTGCAGCAGCTGCCGCCGCTGCAGAATGCTGCTGCTGCAATGCCTCGACGCTTCATGAGTAACAGTGCTCCGCTGCCTGCCC[A/G]
AGAAAGGACAGCAAACGCGCTGCTCAAATTAATCAACGCCACCCAGCGACAGCAGGACGGCAGCGATAAACCCCCCACCCCCCACATAGACTGCTCAAAA

Reverse complement sequence

TTTTGAGCAGTCTATGTGGGGGGTGGGGGGTTTATCGCTGCCGTCCTGCTGTCGCTGGGTGGCGTTGATTAATTTGAGCAGCGCGTTTGCTGTCCTTTCT[T/C]
GGGCAGGCAGCGGAGCACTGTTACTCATGAAGCGTCGAGGCATTGCAGCAGCAGCATTCTGCAGCGGCGGCAGCTGCTGCAGCTGGAGTAGTACTCCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 48.20% 0.76% 0.00% NA
All Indica  2759 61.70% 37.90% 0.43% 0.00% NA
All Japonica  1512 43.10% 55.60% 1.39% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 86.40% 13.30% 0.34% 0.00% NA
Indica II  465 43.20% 56.60% 0.22% 0.00% NA
Indica III  913 64.50% 35.40% 0.11% 0.00% NA
Indica Intermediate  786 50.60% 48.30% 1.02% 0.00% NA
Temperate Japonica  767 36.00% 61.40% 2.61% 0.00% NA
Tropical Japonica  504 52.60% 47.40% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 53.90% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 40.00% 56.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106684036 A -> G LOC_Os01g12230-LOC_Os01g12240 intergenic_region ; MODIFIER silent_mutation Average:78.372; most accessible tissue: Zhenshan97 panicle, score: 98.719 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106684036 A G -0.07 -0.05 -0.04 -0.04 -0.1 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106684036 6.66E-06 1.24E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 NA 4.93E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 NA 9.94E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 5.50E-10 1.07E-12 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 1.32E-10 8.47E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 1.03E-12 5.11E-15 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 3.62E-06 NA mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 4.30E-10 3.02E-16 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 2.12E-06 8.54E-09 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 4.92E-09 2.45E-14 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 4.55E-06 NA mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 NA 1.94E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 NA 2.49E-06 mr1362_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 1.41E-13 6.23E-19 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 1.61E-11 1.61E-12 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 1.19E-19 1.09E-20 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 3.52E-10 1.91E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 2.47E-08 NA mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 NA 1.95E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 1.94E-10 3.50E-15 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 8.11E-10 1.12E-11 mr1925_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 6.87E-09 1.33E-11 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 3.01E-09 2.85E-09 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106684036 5.40E-06 1.97E-09 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251