Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106626230:

Variant ID: vg0106626230 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6626230
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAAGAAAAGTATACTAGACATAATAGATTGGCCCCCATCTCTGCTCTAGCTAGGTAGCTGAGCTGAGCTTGTACATGTTCTTGCATATGTACCTGCT[T/G]
CCCACTTGGGCTGTGCCGGGTAGCCTGTCACCGATTCTTATCCGATTACCTGACATGACCACAGAAGAATTCTTCGTCGTCGTCTCCTCTTTCGTTTGTG

Reverse complement sequence

CACAAACGAAAGAGGAGACGACGACGAAGAATTCTTCTGTGGTCATGTCAGGTAATCGGATAAGAATCGGTGACAGGCTACCCGGCACAGCCCAAGTGGG[A/C]
AGCAGGTACATATGCAAGAACATGTACAAGCTCAGCTCAGCTACCTAGCTAGAGCAGAGATGGGGGCCAATCTATTATGTCTAGTATACTTTTCTTCTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.60% 0.40% 0.00% NA
All Indica  2759 60.80% 38.90% 0.29% 0.00% NA
All Japonica  1512 73.30% 26.00% 0.73% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 40.50% 59.00% 0.50% 0.00% NA
Indica II  465 74.60% 25.20% 0.22% 0.00% NA
Indica III  913 71.70% 28.00% 0.22% 0.00% NA
Indica Intermediate  786 55.30% 44.40% 0.25% 0.00% NA
Temperate Japonica  767 87.00% 11.60% 1.43% 0.00% NA
Tropical Japonica  504 66.70% 33.30% 0.00% 0.00% NA
Japonica Intermediate  241 43.60% 56.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106626230 T -> G LOC_Os01g12160.2 downstream_gene_variant ; 1078.0bp to feature; MODIFIER silent_mutation Average:76.28; most accessible tissue: Callus, score: 97.429 N N N N
vg0106626230 T -> G LOC_Os01g12160.1 intron_variant ; MODIFIER silent_mutation Average:76.28; most accessible tissue: Callus, score: 97.429 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106626230 T G 0.03 0.09 0.05 0.17 0.12 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106626230 NA 2.52E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 2.03E-06 NA mr1769 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 6.74E-06 2.13E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 NA 6.15E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 4.74E-09 8.19E-14 mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 1.04E-06 NA mr1769_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 NA 4.34E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106626230 NA 3.46E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251