Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106611962:

Variant ID: vg0106611962 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6611962
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCTCTATAAAATATGTACATCTCAGCAATACACTAGATTAATGGTAAACCACCTCAATAGTATATCTACATGGGTATCTATAGCTCTCTAATCCATTG[C/T]
CTCGTTTTTCTCTATAGACTATCTTCAGGTTAATAGATAGCTTTGCTCTCTCTCTTCATTTAATCTCTTCCAAGAGAAAAAATATGCTGACATGGATCTC

Reverse complement sequence

GAGATCCATGTCAGCATATTTTTTCTCTTGGAAGAGATTAAATGAAGAGAGAGAGCAAAGCTATCTATTAACCTGAAGATAGTCTATAGAGAAAAACGAG[G/A]
CAATGGATTAGAGAGCTATAGATACCCATGTAGATATACTATTGAGGTGGTTTACCATTAATCTAGTGTATTGCTGAGATGTACATATTTTATAGAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	16.30%	0.04%	0.00%	NA
All Indica	2759	72.40%	27.50%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	54.60%	45.40%	0.00%	0.00%	NA
Indica II	465	75.10%	24.90%	0.00%	0.00%	NA
Indica III	913	77.80%	22.20%	0.00%	0.00%	NA
Indica Intermediate	786	78.00%	21.80%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106611962	C -> T	LOC_Os01g12120.1	upstream_gene_variant ; 4723.0bp to feature; MODIFIER	silent_mutation	Average:66.034; most accessible tissue: Callus, score: 89.928	N	N	N	N
vg0106611962	C -> T	LOC_Os01g12140.1	upstream_gene_variant ; 3441.0bp to feature; MODIFIER	silent_mutation	Average:66.034; most accessible tissue: Callus, score: 89.928	N	N	N	N
vg0106611962	C -> T	LOC_Os01g12130.1	downstream_gene_variant ; 381.0bp to feature; MODIFIER	silent_mutation	Average:66.034; most accessible tissue: Callus, score: 89.928	N	N	N	N
vg0106611962	C -> T	LOC_Os01g12150.1	downstream_gene_variant ; 4770.0bp to feature; MODIFIER	silent_mutation	Average:66.034; most accessible tissue: Callus, score: 89.928	N	N	N	N
vg0106611962	C -> T	LOC_Os01g12120-LOC_Os01g12130	intergenic_region ; MODIFIER	silent_mutation	Average:66.034; most accessible tissue: Callus, score: 89.928	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106611962	NA	1.22E-06	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	NA	1.82E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	NA	3.26E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	2.51E-06	3.69E-11	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	8.01E-06	5.93E-08	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	3.05E-07	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	4.46E-08	3.22E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	NA	2.75E-08	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	6.21E-06	2.53E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106611962	1.88E-06	1.31E-07	mr1951_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251