Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106604863:

Variant ID: vg0106604863 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 6604863
Reference Allele: T	Alternative Allele: C,TAGTAGGAGATGTGACGAACTTAAC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGCTTCATGGTTGGATATGATAGATCAGAGGTAGTGTACGGTAGTAGGATATGTTACTCAATCATGTTAGGTACTCCCACCGTCCTAAAAGAACTTAA[T/C,TAGTAGGAGATGTGACGAACTTAAC]
ATAGTAGGAGATGTGACTCCTCGTAGGACAACGAATCTGGACAAAGGGTAGTCCAGATTCATTGTCCTACGAGGGATATTACATCTTCTCCTAGGTTAAG

Reverse complement sequence

CTTAACCTAGGAGAAGATGTAATATCCCTCGTAGGACAATGAATCTGGACTACCCTTTGTCCAGATTCGTTGTCCTACGAGGAGTCACATCTCCTACTAT[A/G,GTTAAGTTCGTCACATCTCCTACTA]
TTAAGTTCTTTTAGGACGGTGGGAGTACCTAACATGATTGAGTAACATATCCTACTACCGTACACTACCTCTGATCTATCATATCCAACCATGAAGCCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	31.70%	0.11%	0.00%	TAGTAGGAGATGTGACGAACTTAAC: 0.04%
All Indica	2759	65.50%	34.30%	0.18%	0.00%	NA
All Japonica	1512	87.40%	12.60%	0.00%	0.00%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	53.30%	46.40%	0.34%	0.00%	NA
Indica II	465	68.00%	31.80%	0.22%	0.00%	NA
Indica III	913	69.30%	30.60%	0.11%	0.00%	NA
Indica Intermediate	786	68.80%	31.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	77.40%	22.60%	0.00%	0.00%	NA
Japonica Intermediate	241	70.10%	29.90%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	72.20%	25.60%	0.00%	0.00%	TAGTAGGAGATGTGACGAACTTAAC: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106604863	T -> TAGTAGGAGATGTGACGAACTTAAC	LOC_Os01g12120.1	downstream_gene_variant ; 1657.0bp to feature; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Callus, score: 92.322	N	N	N	N
vg0106604863	T -> TAGTAGGAGATGTGACGAACTTAAC	LOC_Os01g12110-LOC_Os01g12120	intergenic_region ; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Callus, score: 92.322	N	N	N	N
vg0106604863	T -> C	LOC_Os01g12120.1	downstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Callus, score: 92.322	N	N	N	N
vg0106604863	T -> C	LOC_Os01g12110-LOC_Os01g12120	intergenic_region ; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Callus, score: 92.322	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106604863	NA	4.34E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863	2.02E-07	NA	mr1769_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863	6.08E-06	NA	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863	3.96E-06	NA	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106604863	NA	6.93E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251