Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106296081:

Variant ID: vg0106296081 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6296081
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TCACTCACCAATGGCTCCGCCGCCGGCGGCGCTTCTCCTCGTCGTGCTCCTGCTCGTCGGCTTCGTTAGCGCCAGAGCCATCACACCCTCAGCTTAAGCG[G/T]
CGGCGGCGTTCCCCAAGGAAGCCCTGCCGACCAAGTCCGGCTACCTCCCCATCCCGACAGCCAACGCCTCGCTCTTCTTCGCCTACTACGAGGCCACGCA

Reverse complement sequence

TGCGTGGCCTCGTAGTAGGCGAAGAAGAGCGAGGCGTTGGCTGTCGGGATGGGGAGGTAGCCGGACTTGGTCGGCAGGGCTTCCTTGGGGAACGCCGCCG[C/A]
CGCTTAAGCTGAGGGTGTGATGGCTCTGGCGCTAACGAAGCCGACGAGCAGGAGCACGACGAGGAGAAGCGCCGCCGGCGGCGGAGCCATTGGTGAGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 48.90% 0.06% 0.47% NA
All Indica  2759 17.60% 81.60% 0.07% 0.76% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 10.40% 89.20% 0.00% 0.34% NA
Indica II  465 22.80% 77.00% 0.22% 0.00% NA
Indica III  913 6.40% 91.70% 0.00% 1.97% NA
Indica Intermediate  786 33.10% 66.70% 0.13% 0.13% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106296081 G -> T LOC_Os01g11660.1 downstream_gene_variant ; 3778.0bp to feature; MODIFIER silent_mutation Average:80.748; most accessible tissue: Zhenshan97 flag leaf, score: 95.277 N N N N
vg0106296081 G -> T LOC_Os01g11680.1 downstream_gene_variant ; 2863.0bp to feature; MODIFIER silent_mutation Average:80.748; most accessible tissue: Zhenshan97 flag leaf, score: 95.277 N N N N
vg0106296081 G -> T LOC_Os01g11670.1 intron_variant ; MODIFIER silent_mutation Average:80.748; most accessible tissue: Zhenshan97 flag leaf, score: 95.277 N N N N
vg0106296081 G -> DEL N N silent_mutation Average:80.748; most accessible tissue: Zhenshan97 flag leaf, score: 95.277 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106296081 G T -0.02 -0.05 -0.08 -0.07 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106296081 NA 2.78E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 1.01E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 2.68E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 2.39E-09 3.46E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 1.54E-20 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 2.09E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 1.14E-06 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 1.23E-07 7.36E-12 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 3.33E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 2.72E-17 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 7.87E-07 2.15E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 1.15E-25 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 4.40E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 5.32E-06 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 3.05E-07 NA mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 2.72E-09 9.02E-15 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 1.65E-07 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 2.47E-08 2.44E-12 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 6.94E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 7.20E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 3.55E-09 1.12E-16 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 7.34E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 1.13E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 2.24E-25 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 NA 4.51E-08 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 5.09E-06 3.26E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 2.87E-08 5.05E-38 mr1943_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 7.41E-08 2.24E-13 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106296081 7.96E-06 1.86E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251