Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106285349:

Variant ID: vg0106285349 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6285349
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGCTAAATTGTGGATGCTGGAAAAATCATATGGGCTGAATTGTGCGGGTTAGAAAAATCATATGGGCCAAATTGGAGTGGGCTGAAAATTTGTACAAG[C/T]
TGCACTCATAAACAAACAATCAAAAAATATGCTGGGTCAGCTAGCAACAACCCTAGAAAAAATATATTTGTGGCCCATGAGCTACATGGCTTTAGCATGC

Reverse complement sequence

GCATGCTAAAGCCATGTAGCTCATGGGCCACAAATATATTTTTTCTAGGGTTGTTGCTAGCTGACCCAGCATATTTTTTGATTGTTTGTTTATGAGTGCA[G/A]
CTTGTACAAATTTTCAGCCCACTCCAATTTGGCCCATATGATTTTTCTAACCCGCACAATTCAGCCCATATGATTTTTCCAGCATCCACAATTTAGCCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	29.20%	0.06%	0.00%	NA
All Indica	2759	96.20%	3.70%	0.11%	0.00%	NA
All Japonica	1512	20.00%	80.00%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	95.00%	4.70%	0.33%	0.00%	NA
Indica Intermediate	786	93.10%	6.90%	0.00%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	47.40%	52.60%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	83.80%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106285349	C -> T	LOC_Os01g11660.1	upstream_gene_variant ; 3016.0bp to feature; MODIFIER	silent_mutation	Average:88.486; most accessible tissue: Minghui63 young leaf, score: 96.718	N	N	N	N
vg0106285349	C -> T	LOC_Os01g11650.1	downstream_gene_variant ; 1697.0bp to feature; MODIFIER	silent_mutation	Average:88.486; most accessible tissue: Minghui63 young leaf, score: 96.718	N	N	N	N
vg0106285349	C -> T	LOC_Os01g11650.2	downstream_gene_variant ; 3607.0bp to feature; MODIFIER	silent_mutation	Average:88.486; most accessible tissue: Minghui63 young leaf, score: 96.718	N	N	N	N
vg0106285349	C -> T	LOC_Os01g11650-LOC_Os01g11660	intergenic_region ; MODIFIER	silent_mutation	Average:88.486; most accessible tissue: Minghui63 young leaf, score: 96.718	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0106285349	C	T	-0.13	-0.08	-0.06	-0.08	-0.07	-0.11

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106285349	5.65E-06	NA	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0106285349	NA	1.90E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	4.69E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	2.80E-36	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	1.66E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	2.12E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	9.14E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	2.49E-41	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	5.34E-44	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	1.56E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	1.13E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	1.05E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106285349	NA	5.20E-08	mr1805_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251