Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106130897:

Variant ID: vg0106130897 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6130897
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTGCTAAGATGGCATACATAACTCGCCTATTTGTAAATAGATTTGAAATAGCACATGGATGGATGGATGGAGCACTGGATTGTCCTGGACTAACGGC[A/T]
CAAGTTAAGATCTAAAAAATAAGTTTAATAATAATAATAATAAAATAACTGATGAACCTGCTGATCTGTTGGATGAGAGTGGTAGATCTATTCCTCAGGA

Reverse complement sequence

TCCTGAGGAATAGATCTACCACTCTCATCCAACAGATCAGCAGGTTCATCAGTTATTTTATTATTATTATTATTAAACTTATTTTTTAGATCTTAACTTG[T/A]
GCCGTTAGTCCAGGACAATCCAGTGCTCCATCCATCCATCCATGTGCTATTTCAAATCTATTTACAAATAGGCGAGTTATGTATGCCATCTTAGCAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.40%	12.60%	0.00%	0.00%	NA
All Indica	2759	91.50%	8.50%	0.00%	0.00%	NA
All Japonica	1512	76.70%	23.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.10%	7.90%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	78.50%	21.50%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	36.50%	63.50%	0.00%	0.00%	NA
Japonica Intermediate	241	90.90%	9.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106130897	A -> T	LOC_Os01g11390.1	upstream_gene_variant ; 1160.0bp to feature; MODIFIER	silent_mutation	Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735	N	N	N	N
vg0106130897	A -> T	LOC_Os01g11414.1	upstream_gene_variant ; 3305.0bp to feature; MODIFIER	silent_mutation	Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735	N	N	N	N
vg0106130897	A -> T	LOC_Os01g11400.1	downstream_gene_variant ; 1393.0bp to feature; MODIFIER	silent_mutation	Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735	N	N	N	N
vg0106130897	A -> T	LOC_Os01g11390-LOC_Os01g11400	intergenic_region ; MODIFIER	silent_mutation	Average:57.727; most accessible tissue: Zhenshan97 root, score: 90.735	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106130897	NA	1.40E-17	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	1.56E-13	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	2.60E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	8.50E-12	mr1800	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	3.23E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	4.78E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	5.94E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	1.00E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	1.20E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	4.66E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	8.44E-10	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106130897	NA	3.32E-07	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251