| Variant ID: vg0106064396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6064396 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 94. )
CTCAAGTGTGTCTCTAGAAATGTAAATTGCACAAATGTAAATGCGACAATCAAATGAGACAATGAGACAAGAGATTTTTCACCGAGGTTCGAGAACTCGC[C/T]
GGTTTCCTACTCCCCGTTGAGGCAAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCC
GGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTTGCCTCAACGGGGAGTAGGAAACC[G/A]
GCGAGTTCTCGAACCTCGGTGAAAAATCTCTTGTCTCATTGTCTCATTTGATTGTCGCATTTACATTTGTGCAATTTACATTTCTAGAGACACACTTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 15.40% | 10.18% | 14.35% | NA |
| All Indica | 2759 | 61.60% | 8.80% | 8.23% | 21.38% | NA |
| All Japonica | 1512 | 65.50% | 17.50% | 11.77% | 5.22% | NA |
| Aus | 269 | 3.70% | 72.90% | 23.42% | 0.00% | NA |
| Indica I | 595 | 91.40% | 4.20% | 3.19% | 1.18% | NA |
| Indica II | 465 | 63.40% | 7.10% | 15.05% | 14.41% | NA |
| Indica III | 913 | 45.90% | 5.50% | 5.59% | 43.04% | NA |
| Indica Intermediate | 786 | 56.20% | 17.00% | 11.07% | 15.65% | NA |
| Temperate Japonica | 767 | 95.70% | 1.30% | 2.61% | 0.39% | NA |
| Tropical Japonica | 504 | 30.60% | 43.50% | 12.90% | 13.10% | NA |
| Japonica Intermediate | 241 | 42.70% | 14.50% | 38.59% | 4.15% | NA |
| VI/Aromatic | 96 | 83.30% | 14.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 14.40% | 12.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106064396 | C -> T | LOC_Os01g11310.1 | upstream_gene_variant ; 462.0bp to feature; MODIFIER | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064396 | C -> T | LOC_Os01g11330.1 | upstream_gene_variant ; 4402.0bp to feature; MODIFIER | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064396 | C -> T | LOC_Os01g11320.1 | downstream_gene_variant ; 1287.0bp to feature; MODIFIER | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064396 | C -> T | LOC_Os01g11310-LOC_Os01g11320 | intergenic_region ; MODIFIER | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064396 | C -> DEL | N | N | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106064396 | NA | 1.23E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 3.78E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 5.14E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | 4.73E-11 | 1.23E-13 | mr1310_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | 8.52E-06 | 2.45E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 3.86E-06 | mr1607_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 2.29E-13 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 2.41E-09 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 2.80E-08 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | 1.49E-06 | 9.56E-08 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064396 | NA | 7.10E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |