Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105752914:

Variant ID: vg0105752914 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5752914
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCTATAAGGACTTTATCTTTTTCTTTTATCTATAGGAAAGTTTCTTTCTTGTCCAACAAGGACT[T/A]
GTATCAACCCATGGGTATAAATATGTACACCCGGGGTCTATGTAATTAATCTCATGATCAATACAATTCGGCGCATCGCCACCTTTTACCTTTTCTACTT

Reverse complement sequence

AAGTAGAAAAGGTAAAAGGTGGCGATGCGCCGAATTGTATTGATCATGAGATTAATTACATAGACCCCGGGTGTACATATTTATACCCATGGGTTGATAC[A/T]
AGTCCTTGTTGGACAAGAAAGAAACTTTCCTATAGATAAAAGAAAAAGATAAAGTCCTTATAGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	8.40%	7.17%	9.06%	NA
All Indica	2759	66.50%	11.00%	10.47%	12.07%	NA
All Japonica	1512	87.00%	5.60%	2.78%	4.63%	NA
Aus	269	89.20%	0.70%	2.23%	7.81%	NA
Indica I	595	15.30%	35.60%	23.36%	25.71%	NA
Indica II	465	92.00%	0.90%	3.01%	4.09%	NA
Indica III	913	87.70%	2.30%	6.02%	3.94%	NA
Indica Intermediate	786	65.40%	8.40%	10.31%	15.90%	NA
Temperate Japonica	767	98.60%	0.70%	0.26%	0.52%	NA
Tropical Japonica	504	71.60%	14.10%	5.56%	8.73%	NA
Japonica Intermediate	241	82.20%	3.70%	4.98%	9.13%	NA
VI/Aromatic	96	96.90%	1.00%	1.04%	1.04%	NA
Intermediate	90	90.00%	5.60%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105752914	T -> A	LOC_Os01g10740.1	upstream_gene_variant ; 3644.0bp to feature; MODIFIER	silent_mutation	Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0105752914	T -> A	LOC_Os01g10760.1	upstream_gene_variant ; 1879.0bp to feature; MODIFIER	silent_mutation	Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0105752914	T -> A	LOC_Os01g10750.1	downstream_gene_variant ; 2479.0bp to feature; MODIFIER	silent_mutation	Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0105752914	T -> A	LOC_Os01g10770.1	downstream_gene_variant ; 4577.0bp to feature; MODIFIER	silent_mutation	Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0105752914	T -> A	LOC_Os01g10760-LOC_Os01g10770	intergenic_region ; MODIFIER	silent_mutation	Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0105752914	T -> DEL	N	N	silent_mutation	Average:29.154; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105752914	2.89E-06	1.27E-06	mr1160_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251