Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105635044:

Variant ID: vg0105635044 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5635044
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACTGACGGATTATATAATTATTTTTTTATTAGTACTCGAACACCTCATACGACACTCTATAGAATATCTGATGTGATGTGACACGTCAAAAATTTAAA[T/A]
TTTTTTTTATGTAAACAACCCCTTTTATCATCTGCGTCCTCCTATTTCTGTGTGGCGATTAAAAGTACGTTCACCGCATCGATCCCCATGAAAAGCGTTG

Reverse complement sequence

CAACGCTTTTCATGGGGATCGATGCGGTGAACGTACTTTTAATCGCCACACAGAAATAGGAGGACGCAGATGATAAAAGGGGTTGTTTACATAAAAAAAA[A/T]
TTTAAATTTTTGACGTGTCACATCACATCAGATATTCTATAGAGTGTCGTATGAGGTGTTCGAGTACTAATAAAAAAATAATTATATAATCCGTCAGTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 35.90% 0.08% 0.28% NA
All Indica  2759 54.00% 45.80% 0.11% 0.00% NA
All Japonica  1512 90.40% 9.60% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 52.10% 47.90% 0.00% 0.00% NA
Indica II  465 77.80% 22.20% 0.00% 0.00% NA
Indica III  913 40.60% 59.30% 0.11% 0.00% NA
Indica Intermediate  786 57.00% 42.70% 0.25% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 80.20% 19.80% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.90% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 8.30% 0.00% 12.50% NA
Intermediate  90 70.00% 27.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105635044 T -> A LOC_Os01g10580.1 upstream_gene_variant ; 4725.0bp to feature; MODIFIER silent_mutation Average:71.86; most accessible tissue: Zhenshan97 young leaf, score: 93.764 N N N N
vg0105635044 T -> A LOC_Os01g10560-LOC_Os01g10580 intergenic_region ; MODIFIER silent_mutation Average:71.86; most accessible tissue: Zhenshan97 young leaf, score: 93.764 N N N N
vg0105635044 T -> DEL N N silent_mutation Average:71.86; most accessible tissue: Zhenshan97 young leaf, score: 93.764 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105635044 T A -0.01 -0.03 -0.04 0.0 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105635044 3.42E-08 5.43E-15 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 1.28E-06 1.58E-12 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 NA 5.61E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 7.95E-07 3.54E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 9.04E-06 1.59E-10 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 NA 1.71E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 6.53E-08 NA mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 1.75E-06 1.34E-11 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 NA 7.92E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 4.26E-08 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 NA 4.78E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105635044 NA 8.95E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251