Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105632160:

Variant ID: vg0105632160 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5632160
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCCGAAAGTCGTCGGTGTCACCCGATACCGGTCATTGTACTGTAGATCCGCCCCGACTATCACTGGAACGCGCGCACACACATCATGGCCAGTGAAC[G/A]
GAGCCAAAAAAATTTTAGAGCTCTAGCAAACTTCAATATAACTAGTACAGTATTTGTTATGGAAATTTCGCCATCAAGTTGCTCATCAATATCGAAATTT

Reverse complement sequence

AAATTTCGATATTGATGAGCAACTTGATGGCGAAATTTCCATAACAAATACTGTACTAGTTATATTGAAGTTTGCTAGAGCTCTAAAATTTTTTTGGCTC[C/T]
GTTCACTGGCCATGATGTGTGTGCGCGCGTTCCAGTGATAGTCGGGGCGGATCTACAGTACAATGACCGGTATCGGGTGACACCGACGACTTTCGGCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 25.20% 0.08% 0.28% NA
All Indica  2759 65.80% 34.10% 0.14% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 78.90% 21.10% 0.00% 0.00% NA
Indica III  913 42.30% 57.60% 0.11% 0.00% NA
Indica Intermediate  786 65.10% 34.50% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 7.30% 0.00% 12.50% NA
Intermediate  90 76.70% 22.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105632160 G -> A LOC_Os01g10560-LOC_Os01g10580 intergenic_region ; MODIFIER silent_mutation Average:93.429; most accessible tissue: Minghui63 young leaf, score: 97.146 N N N N
vg0105632160 G -> DEL N N silent_mutation Average:93.429; most accessible tissue: Minghui63 young leaf, score: 97.146 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105632160 G A -0.02 -0.01 -0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105632160 NA 4.54E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 NA 1.30E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 NA 8.69E-08 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 4.97E-06 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 3.70E-06 NA mr1498_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 NA 2.71E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 NA 4.65E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105632160 NA 3.44E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251