Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105393860:

Variant ID: vg0105393860 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5393860
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCCCCCACCAATCCACCAATGGGAGAAGATCGATTTTAAAAAAATTGAATCGATGTGTCCAACAAGAAAACGAAATCGCCATAAGCCAACAAAAAAAA[C/A]
AAGCCACTGATCCCCTCCACAACAATCCAAACCACTATACCGAAGGAAAAATTGATCGCCGAACCCTCCGTGCTCACCTCATCTCGGCGGCGGCGGCGGC

Reverse complement sequence

GCCGCCGCCGCCGCCGAGATGAGGTGAGCACGGAGGGTTCGGCGATCAATTTTTCCTTCGGTATAGTGGTTTGGATTGTTGTGGAGGGGATCAGTGGCTT[G/T]
TTTTTTTTGTTGGCTTATGGCGATTTCGTTTTCTTGTTGGACACATCGATTCAATTTTTTTAAAATCGATCTTCTCCCATTGGTGGATTGGTGGGGGAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.70% 0.20% 0.11% 0.00% NA
All Indica  2759 99.50% 0.30% 0.18% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.40% 0.43% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105393860 C -> A LOC_Os01g10250.2 5_prime_UTR_variant ; 1424.0bp to feature; MODIFIER N Average:87.15; most accessible tissue: Zhenshan97 flag leaf, score: 97.492 N N N N
vg0105393860 C -> A LOC_Os01g10250.1 intron_variant ; MODIFIER N Average:87.15; most accessible tissue: Zhenshan97 flag leaf, score: 97.492 N N N N
vg0105393860 C -> A LOC_Os01g10250.3 intron_variant ; MODIFIER N Average:87.15; most accessible tissue: Zhenshan97 flag leaf, score: 97.492 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105393860 C A -0.02 -0.03 -0.03 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105393860 6.79E-06 6.79E-06 mr1065 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 2.70E-06 NA mr1067 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 2.33E-07 2.34E-07 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 1.63E-06 1.63E-06 mr1110 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 4.58E-06 NA mr1395 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 4.39E-06 NA mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 6.22E-06 6.22E-06 mr1750 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 2.71E-06 NA mr1771 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 3.67E-06 3.67E-06 mr1935 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 3.14E-06 NA mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 9.14E-07 9.14E-07 mr1987 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 1.10E-06 6.15E-06 mr1245_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 4.69E-07 4.11E-06 mr1373_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 8.01E-06 NA mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105393860 1.43E-06 NA mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251