Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105151694:

Variant ID: vg0105151694 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5151694
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTATTAAATTTTTTTTGCAAATATAGAAAAATGAAAAGTTGTGATTAAAGTACTATAGATAATAAGTAAGTCACAAATAAAATAAATAATAATTTCAA[T/A]
TTTTTTTTAAATAAGACGAGTGGTCAAACGTTGCAAGCAAAAACTCTTATATTATGGGACAGAGGGAGTATCTCCTAGCGCTTGAATTCAATGCCGTACT

Reverse complement sequence

AGTACGGCATTGAATTCAAGCGCTAGGAGATACTCCCTCTGTCCCATAATATAAGAGTTTTTGCTTGCAACGTTTGACCACTCGTCTTATTTAAAAAAAA[A/T]
TTGAAATTATTATTTATTTTATTTGTGACTTACTTATTATCTATAGTACTTTAATCACAACTTTTCATTTTTCTATATTTGCAAAAAAAATTTAATAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	19.40%	9.56%	14.77%	NA
All Indica	2759	71.90%	5.10%	12.29%	10.76%	NA
All Japonica	1512	30.60%	46.30%	1.32%	21.83%	NA
Aus	269	51.30%	1.10%	29.37%	18.22%	NA
Indica I	595	46.20%	0.20%	25.04%	28.57%	NA
Indica II	465	70.30%	18.50%	4.73%	6.45%	NA
Indica III	913	92.30%	1.00%	2.63%	4.05%	NA
Indica Intermediate	786	68.40%	5.60%	18.32%	7.63%	NA
Temperate Japonica	767	54.50%	30.00%	0.78%	14.73%	NA
Tropical Japonica	504	2.00%	61.50%	1.98%	34.52%	NA
Japonica Intermediate	241	14.10%	66.40%	1.66%	17.84%	NA
VI/Aromatic	96	25.00%	55.20%	2.08%	17.71%	NA
Intermediate	90	56.70%	24.40%	13.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105151694	T -> A	LOC_Os01g09900.1	downstream_gene_variant ; 1046.0bp to feature; MODIFIER	silent_mutation	Average:48.609; most accessible tissue: Callus, score: 90.273	N	N	N	N
vg0105151694	T -> A	LOC_Os01g09900-LOC_Os01g09930	intergenic_region ; MODIFIER	silent_mutation	Average:48.609; most accessible tissue: Callus, score: 90.273	N	N	N	N
vg0105151694	T -> DEL	N	N	silent_mutation	Average:48.609; most accessible tissue: Callus, score: 90.273	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105151694	3.15E-06	NA	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	8.70E-07	9.62E-20	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	2.27E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	5.98E-07	4.09E-19	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	6.42E-08	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	6.95E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	1.64E-06	3.35E-13	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	2.25E-07	NA	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	1.79E-06	NA	mr1057_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	1.31E-09	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	1.01E-14	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	2.07E-12	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	7.28E-19	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	2.83E-06	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	2.20E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	9.61E-08	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105151694	NA	2.85E-10	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251