RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0105134457:

Variant ID: vg0105134457 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5134457
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GACTGCAAGTTCCCTGTTCCTATTGACTTGCAGAGTCCAGACTCTAAAGATCAGTAGATAGCCATCTACTATCTTCAAATTATCTATAGTTAATGTAATA[A/G]
TCAATTCATACAATAGTTGCTTACTATACTATTAATACCTGGTCTCATCTGTCATACACACATTATGTCTTAGAGTCTGTGCTGCAGCTGGCTACATATC

Reverse complement sequence

GATATGTAGCCAGCTGCAGCACAGACTCTAAGACATAATGTGTGTATGACAGATGAGACCAGGTATTAATAGTATAGTAAGCAACTATTGTATGAATTGA[T/C]
TATTACATTAACTATAGATAATTTGAAGATAGTAGATGGCTATCTACTGATCTTTAGAGTCTGGACTCTGCAAGTCAATAGGAACAGGGAACTTGCAGTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	25.80%	0.32%	0.00%	NA
All Indica	2759	75.40%	24.10%	0.47%	0.00%	NA
All Japonica	1512	77.20%	22.80%	0.00%	0.00%	NA
Aus	269	33.80%	65.80%	0.37%	0.00%	NA
Indica I	595	28.20%	71.30%	0.50%	0.00%	NA
Indica II	465	97.00%	2.60%	0.43%	0.00%	NA
Indica III	913	97.50%	2.30%	0.22%	0.00%	NA
Indica Intermediate	786	72.60%	26.60%	0.76%	0.00%	NA
Temperate Japonica	767	85.00%	15.00%	0.00%	0.00%	NA
Tropical Japonica	504	63.10%	36.90%	0.00%	0.00%	NA
Japonica Intermediate	241	81.70%	18.30%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105134457	A -> G	LOC_Os01g09880.1	upstream_gene_variant ; 1539.0bp to feature; MODIFIER	silent_mutation	Average:67.978; most accessible tissue: Callus, score: 97.824	N	N	N	N
vg0105134457	A -> G	LOC_Os01g09890.1	downstream_gene_variant ; 4006.0bp to feature; MODIFIER	silent_mutation	Average:67.978; most accessible tissue: Callus, score: 97.824	N	N	N	N
vg0105134457	A -> G	LOC_Os01g09880-LOC_Os01g09890	intergenic_region ; MODIFIER	silent_mutation	Average:67.978; most accessible tissue: Callus, score: 97.824	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105134457	4.98E-16	8.65E-22	mr1057	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	1.37E-14	2.01E-20	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	5.85E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	4.56E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	9.73E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	7.58E-10	mr1677	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	2.47E-06	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	1.49E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	NA	9.72E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105134457	3.88E-11	4.86E-16	mr1057_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 16 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0105134457:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact