Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105082156:

Variant ID: vg0105082156 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5082156
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTATAATTTGGTTATTACAAATCTTATAATATATGAAAAATTATAAGCTAAGGATTAATTTTGTAAACCATACCAAGTTTGATCGTGCCTTATATTAT[G/A]
GAATAGTGAGAGTACAACCCACCACATATAAAATTCCCATCGACTCGTATTCCTAATTAAGATCATGATCCTTGAGTTATTTTTTAATGGAAATATAACT

Reverse complement sequence

AGTTATATTTCCATTAAAAAATAACTCAAGGATCATGATCTTAATTAGGAATACGAGTCGATGGGAATTTTATATGTGGTGGGTTGTACTCTCACTATTC[C/T]
ATAATATAAGGCACGATCAAACTTGGTATGGTTTACAAAATTAATCCTTAGCTTATAATTTTTCATATATTATAAGATTTGTAATAACCAAATTATAACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	17.10%	0.17%	0.00%	NA
All Indica	2759	76.70%	23.10%	0.25%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	42.80%	56.90%	0.37%	0.00%	NA
Indica I	595	27.60%	72.30%	0.17%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	97.70%	2.20%	0.11%	0.00%	NA
Indica Intermediate	786	77.20%	22.30%	0.51%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105082156	G -> A	LOC_Os01g09830.1	upstream_gene_variant ; 3677.0bp to feature; MODIFIER	silent_mutation	Average:45.881; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0105082156	G -> A	LOC_Os01g09810-LOC_Os01g09830	intergenic_region ; MODIFIER	silent_mutation	Average:45.881; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105082156	NA	8.70E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	3.52E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	6.75E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	9.45E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	4.72E-12	mr1482_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	4.52E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	4.20E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	3.89E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156	NA	9.33E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251