Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105068923:

Variant ID: vg0105068923 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5068923
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGAGCAGTTGATGATATCGTGCGAGCTAGCTTAGCGACGACACGAGACCCCCAAATCAGAAAGGGCTTGGCTGAGCACAAAGCAGTGTCTCATAGAT[C/A]
AAGATGAGAGATCAAATGATCGAGTCGCAATCGCGTCTTGTCGATCCAAATTCCTAACTAACGAGTACTGTGGTGTTTGGATCAGGGACTTAACTTTAGT

Reverse complement sequence

ACTAAAGTTAAGTCCCTGATCCAAACACCACAGTACTCGTTAGTTAGGAATTTGGATCGACAAGACGCGATTGCGACTCGATCATTTGATCTCTCATCTT[G/T]
ATCTATGAGACACTGCTTTGTGCTCAGCCAAGCCCTTTCTGATTTGGGGGTCTCGTGTCGTCGCTAAGCTAGCTCGCACGATATCATCAACTGCTCTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 22.40% 0.23% 0.00% NA
All Indica  2759 94.40% 5.50% 0.07% 0.00% NA
All Japonica  1512 45.50% 54.20% 0.26% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 81.10% 18.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.50% 0.11% 0.00% NA
Indica Intermediate  786 93.50% 6.40% 0.13% 0.00% NA
Temperate Japonica  767 71.10% 28.90% 0.00% 0.00% NA
Tropical Japonica  504 12.30% 87.30% 0.40% 0.00% NA
Japonica Intermediate  241 33.60% 65.60% 0.83% 0.00% NA
VI/Aromatic  96 29.20% 67.70% 3.12% 0.00% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105068923 C -> A LOC_Os01g09800.1 upstream_gene_variant ; 3687.0bp to feature; MODIFIER silent_mutation Average:57.783; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0105068923 C -> A LOC_Os01g09810.1 downstream_gene_variant ; 4493.0bp to feature; MODIFIER silent_mutation Average:57.783; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0105068923 C -> A LOC_Os01g09800-LOC_Os01g09810 intergenic_region ; MODIFIER silent_mutation Average:57.783; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105068923 C A 0.13 0.18 0.16 0.01 0.1 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105068923 NA 5.27E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 2.80E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 4.46E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 7.37E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 6.95E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 3.21E-06 2.75E-17 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 4.80E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 1.90E-06 1.90E-06 mr1545 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 9.65E-07 mr1642 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 6.67E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 8.23E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 3.11E-10 1.34E-22 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 4.12E-06 mr1815 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 2.75E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 5.63E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 5.27E-08 4.89E-15 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 1.50E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 4.87E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 7.15E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 9.70E-13 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 1.13E-15 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 7.07E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105068923 NA 1.94E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251