Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105042933:

Variant ID: vg0105042933 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5042933
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAGTATATTTAACAATAAATCAAATGATAAAAAAGAATAAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAATATTTTTAAAAAAGTCAA[C/T]
GGTGTCAAATATTTTGGGACGGAGAGAGTATATAAATAGGCAGATGGACAACATAGTACATGAAGAGATCGAAACAGCGTAACACGCTAGCTATCTTGTA

Reverse complement sequence

TACAAGATAGCTAGCGTGTTACGCTGTTTCGATCTCTTCATGTACTATGTTGTCCATCTGCCTATTTATATACTCTCTCCGTCCCAAAATATTTGACACC[G/A]
TTGACTTTTTTAAAAATATTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTTATTCTTTTTTATCATTTGATTTATTGTTAAATATACTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.00%	0.20%	2.35%	63.48%	NA
All Indica	2759	1.60%	0.30%	2.10%	96.09%	NA
All Japonica	1512	98.10%	0.10%	0.00%	1.85%	NA
Aus	269	1.90%	0.00%	14.50%	83.64%	NA
Indica I	595	0.20%	0.00%	4.54%	95.29%	NA
Indica II	465	3.90%	0.00%	0.22%	95.91%	NA
Indica III	913	1.00%	0.50%	0.33%	98.14%	NA
Indica Intermediate	786	1.90%	0.30%	3.44%	94.40%	NA
Temperate Japonica	767	98.80%	0.00%	0.00%	1.17%	NA
Tropical Japonica	504	97.00%	0.00%	0.00%	2.98%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	38.50%	0.00%	10.42%	51.04%	NA
Intermediate	90	43.30%	0.00%	4.44%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105042933	C -> T	LOC_Os01g09770.1	upstream_gene_variant ; 2235.0bp to feature; MODIFIER	silent_mutation	Average:66.173; most accessible tissue: Callus, score: 88.417	N	N	N	N
vg0105042933	C -> T	LOC_Os01g09770-LOC_Os01g09790	intergenic_region ; MODIFIER	silent_mutation	Average:66.173; most accessible tissue: Callus, score: 88.417	N	N	N	N
vg0105042933	C -> DEL	N	N	silent_mutation	Average:66.173; most accessible tissue: Callus, score: 88.417	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105042933	NA	8.67E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	6.52E-06	NA	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	1.29E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	6.91E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	1.83E-08	mr1745	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	1.39E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	5.67E-09	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	8.93E-08	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933	NA	9.13E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251