Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104831719:

Variant ID: vg0104831719 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4831719
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTAGAATAATGTTTAATTTAAACCTTAGAAATATAAATCATGAATAACTTTTAAGTTATTGATTTAAATTGTTAGGTTTGAAAATGTAAAAATTATAT[G/A]
AATAGATTTATCTTGAAAAATACTTTAATAAAAGTATACATATCACTTTTCAATAAATTTTTTTATAGAAACAAGATGTCAAAATTGTGTTTTGGAGACC

Reverse complement sequence

GGTCTCCAAAACACAATTTTGACATCTTGTTTCTATAAAAAAATTTATTGAAAAGTGATATGTATACTTTTATTAAAGTATTTTTCAAGATAAATCTATT[C/T]
ATATAATTTTTACATTTTCAAACCTAACAATTTAAATCAATAACTTAAAAGTTATTCATGATTTATATTTCTAAGGTTTAAATTAAACATTATTCTAGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.60%	27.10%	0.44%	1.84%	NA
All Indica	2759	94.60%	1.80%	0.62%	3.01%	NA
All Japonica	1512	22.40%	77.40%	0.20%	0.07%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	89.60%	0.70%	0.67%	9.08%	NA
Indica II	465	95.90%	3.20%	0.00%	0.86%	NA
Indica III	913	98.00%	1.00%	0.77%	0.22%	NA
Indica Intermediate	786	93.60%	2.70%	0.76%	2.93%	NA
Temperate Japonica	767	30.50%	69.10%	0.39%	0.00%	NA
Tropical Japonica	504	8.70%	91.30%	0.00%	0.00%	NA
Japonica Intermediate	241	24.90%	74.70%	0.00%	0.41%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	57.80%	37.80%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104831719	G -> A	LOC_Os01g09470.1	downstream_gene_variant ; 2984.0bp to feature; MODIFIER	silent_mutation	Average:70.653; most accessible tissue: Callus, score: 98.374	N	N	N	N
vg0104831719	G -> A	LOC_Os01g09470-LOC_Os01g09480	intergenic_region ; MODIFIER	silent_mutation	Average:70.653; most accessible tissue: Callus, score: 98.374	N	N	N	N
vg0104831719	G -> DEL	N	N	silent_mutation	Average:70.653; most accessible tissue: Callus, score: 98.374	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0104831719	G	A	-0.01	0.0	0.0	-0.03	-0.02	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104831719	2.70E-07	NA	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	5.58E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	1.08E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	2.11E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	3.93E-06	1.61E-07	mr1705	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	2.65E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	6.15E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	1.56E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	4.19E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	3.51E-21	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	1.25E-07	NA	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	1.50E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104831719	NA	2.16E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251