Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104612596:

Variant ID: vg0104612596 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4612596
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTGCATCTGGTTACAATACTCCACTAATGTATACTTGCGTGGCGATCGAAAAAAGTGTTCACACAAATCACAGTAACTAGGTGATATCCCACACTTTG[C/T]
TGCGGGATACATGGATGAATATATATGTTAAATATTGTTGAAATGACGAAAGAAAATGTTGAGAAAAATGTGAGATGATTTGACATATACTTTTTAAGCT

Reverse complement sequence

AGCTTAAAAAGTATATGTCAAATCATCTCACATTTTTCTCAACATTTTCTTTCGTCATTTCAACAATATTTAACATATATATTCATCCATGTATCCCGCA[G/A]
CAAAGTGTGGGATATCACCTAGTTACTGTGATTTGTGTGAACACTTTTTTCGATCGCCACGCAAGTATACATTAGTGGAGTATTGTAACCAGATGCACGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	4.30%	0.61%	15.85%	NA
All Indica	2759	83.20%	0.10%	0.18%	16.53%	NA
All Japonica	1512	85.90%	12.10%	1.39%	0.60%	NA
Aus	269	13.00%	0.00%	1.12%	85.87%	NA
Indica I	595	69.90%	0.00%	0.50%	29.58%	NA
Indica II	465	97.00%	0.20%	0.00%	2.80%	NA
Indica III	913	82.00%	0.00%	0.11%	17.85%	NA
Indica Intermediate	786	86.40%	0.30%	0.13%	13.23%	NA
Temperate Japonica	767	76.10%	21.10%	2.22%	0.52%	NA
Tropical Japonica	504	98.80%	0.00%	0.20%	0.99%	NA
Japonica Intermediate	241	90.00%	8.70%	1.24%	0.00%	NA
VI/Aromatic	96	41.70%	17.70%	0.00%	40.62%	NA
Intermediate	90	83.30%	1.10%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104612596	C -> T	LOC_Os01g09170.1	upstream_gene_variant ; 2594.0bp to feature; MODIFIER	silent_mutation	Average:41.312; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0104612596	C -> T	LOC_Os01g09180.1	upstream_gene_variant ; 548.0bp to feature; MODIFIER	silent_mutation	Average:41.312; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0104612596	C -> T	LOC_Os01g09190.1	upstream_gene_variant ; 2286.0bp to feature; MODIFIER	silent_mutation	Average:41.312; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0104612596	C -> T	LOC_Os01g09180-LOC_Os01g09190	intergenic_region ; MODIFIER	silent_mutation	Average:41.312; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0104612596	C -> DEL	N	N	silent_mutation	Average:41.312; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104612596	NA	6.36E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	8.36E-08	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	9.23E-08	mr1544	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	6.13E-06	NA	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	1.05E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	1.05E-06	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	7.26E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	3.69E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	1.19E-12	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	6.41E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596	NA	2.38E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251