Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104202598:

Variant ID: vg0104202598 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4202598
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.02, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGCGCGCACATGCAGATGCACACGCGTTGCAGAAGTGCAGAGGAGTACTGGTGCCATGGGCCTACGTGTACATGACGCAGCTAGCACTAGCTCGTGGC[A/C]
CTGGGAAATTCACTTTATACACTCCAACACTCCCTCTTACACGAGACCCTATTAAATCTCAAGCGTGCTTCCTCTCACACGAGATCCTATCAAATCTCAA

Reverse complement sequence

TTGAGATTTGATAGGATCTCGTGTGAGAGGAAGCACGCTTGAGATTTAATAGGGTCTCGTGTAAGAGGGAGTGTTGGAGTGTATAAAGTGAATTTCCCAG[T/G]
GCCACGAGCTAGTGCTAGCTGCGTCATGTACACGTAGGCCCATGGCACCAGTACTCCTCTGCACTTCTGCAACGCGTGTGCATCTGCATGTGCGCGCCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 22.30% 7.36% 22.05% NA
All Indica  2759 20.40% 34.70% 10.44% 34.47% NA
All Japonica  1512 87.80% 4.40% 3.44% 4.43% NA
Aus  269 92.60% 1.90% 1.49% 4.09% NA
Indica I  595 26.60% 28.20% 9.24% 35.97% NA
Indica II  465 4.70% 46.70% 13.12% 35.48% NA
Indica III  913 23.70% 32.60% 9.97% 33.73% NA
Indica Intermediate  786 21.20% 34.90% 10.31% 33.59% NA
Temperate Japonica  767 96.90% 0.90% 0.65% 1.56% NA
Tropical Japonica  504 70.20% 10.70% 8.93% 10.12% NA
Japonica Intermediate  241 95.40% 2.10% 0.83% 1.66% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 58.90% 22.20% 4.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104202598 A -> DEL N N silent_mutation Average:98.131; most accessible tissue: Zhenshan97 panicle, score: 99.254 N N N N
vg0104202598 A -> C LOC_Os01g08500.1 upstream_gene_variant ; 1282.0bp to feature; MODIFIER silent_mutation Average:98.131; most accessible tissue: Zhenshan97 panicle, score: 99.254 N N N N
vg0104202598 A -> C LOC_Os01g08490.1 downstream_gene_variant ; 3765.0bp to feature; MODIFIER silent_mutation Average:98.131; most accessible tissue: Zhenshan97 panicle, score: 99.254 N N N N
vg0104202598 A -> C LOC_Os01g08500-LOC_Os01g08510 intergenic_region ; MODIFIER silent_mutation Average:98.131; most accessible tissue: Zhenshan97 panicle, score: 99.254 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104202598 A C 0.03 0.18 0.17 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104202598 NA 1.25E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 5.10E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 5.97E-07 NA mr1263 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 2.62E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 6.33E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 5.97E-07 NA mr1451 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 7.30E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 6.18E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 5.27E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 2.41E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 3.53E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 1.39E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 1.46E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104202598 NA 6.97E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251