Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104077013:

Variant ID: vg0104077013 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4077013
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATACTTAATTAAATCTAAAGAAATTTAACTAATAAAAAAATCAATGCGAGTTATAATATAAAATACGGAATAGAGAGACGTAGATTATTAATCATTAC[G/A]
TTATTTTTTAGGAATATGTATTTAATTATAAAAATAAAAATATTTCAGAAAATAATTTTTACAAATAGTTTACAACAAGTAATCTAACCAGTGCATAAAA

Reverse complement sequence

TTTTATGCACTGGTTAGATTACTTGTTGTAAACTATTTGTAAAAATTATTTTCTGAAATATTTTTATTTTTATAATTAAATACATATTCCTAAAAAATAA[C/T]
GTAATGATTAATAATCTACGTCTCTCTATTCCGTATTTTATATTATAACTCGCATTGATTTTTTTATTAGTTAAATTTCTTTAGATTTAATTAAGTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.90% 0.04% 0.00% NA
All Indica  2759 91.80% 8.20% 0.04% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 10.40% 89.20% 0.37% 0.00% NA
Indica I  595 85.90% 13.90% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 11.20% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104077013 G -> A LOC_Os01g08320.1 upstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:89.491; most accessible tissue: Zhenshan97 flower, score: 94.476 N N N N
vg0104077013 G -> A LOC_Os01g08330.1 upstream_gene_variant ; 4303.0bp to feature; MODIFIER silent_mutation Average:89.491; most accessible tissue: Zhenshan97 flower, score: 94.476 N N N N
vg0104077013 G -> A LOC_Os01g08320-LOC_Os01g08330 intergenic_region ; MODIFIER silent_mutation Average:89.491; most accessible tissue: Zhenshan97 flower, score: 94.476 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104077013 G A 0.0 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104077013 NA 1.93E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 3.79E-31 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 5.92E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 1.68E-15 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 3.87E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 2.67E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 3.59E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 4.53E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 2.49E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 2.27E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 4.05E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 6.44E-26 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 5.69E-26 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 4.89E-19 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 4.44E-18 mr1918 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 2.49E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 1.34E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 7.48E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 1.13E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 1.43E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 2.46E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 1.58E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 1.93E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 9.64E-16 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104077013 NA 2.52E-13 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251