Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103605322:

Variant ID: vg0103605322 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3605322
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGAGGTTCGCAGAATTAAACACACGTATTAAAAAAGAAATATAATTAAATGTGAGAATGTGATGATTGGTCAAGAAGTGAAGATATGGTAAAAAGGAG[A/T]
ACATTGGTGTAAAAATTATTATGTTTTGGGATAAATCTTAAATACTGGAAATTACTTTCTCTATCCCAAATTGATCATATAACCAAATGACACAAAGACT

Reverse complement sequence

AGTCTTTGTGTCATTTGGTTATATGATCAATTTGGGATAGAGAAAGTAATTTCCAGTATTTAAGATTTATCCCAAAACATAATAATTTTTACACCAATGT[T/A]
CTCCTTTTTACCATATCTTCACTTCTTGACCAATCATCACATTCTCACATTTAATTATATTTCTTTTTTAATACGTGTGTTTAATTCTGCGAACCTCATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	9.40%	0.04%	0.00%	NA
All Indica	2759	93.90%	6.10%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	87.40%	12.50%	0.11%	0.00%	NA
Indica Intermediate	786	94.80%	5.10%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103605322	A -> T	LOC_Os01g07530.1	upstream_gene_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:51.1; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0103605322	A -> T	LOC_Os01g07530-LOC_Os01g07540	intergenic_region ; MODIFIER	silent_mutation	Average:51.1; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103605322	NA	4.20E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	1.87E-18	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	1.58E-08	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	3.31E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	3.71E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	8.72E-18	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	4.56E-16	mr1897	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	4.97E-12	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	3.21E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	8.53E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	3.78E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	1.43E-21	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	3.17E-12	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103605322	NA	2.23E-16	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251