Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103508890:

Variant ID: vg0103508890 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3508890
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGTATTTAAATATCTCCAATAACAAACAACTAGCAAATACTACCTCCGTCCCAAAATAAGTGCAGCCATAGATATCCGTGTCCAACGTTTTAACCGTC[T/C]
GTCTTATTTGAAAATTTTATGAAAAAAAATTAAAAATATTAGTCACACATAAAGTACTATTCATGTATTATCATCTAATAACAATAAAAATACTAATCAT

Reverse complement sequence

ATGATTAGTATTTTTATTGTTATTAGATGATAATACATGAATAGTACTTTATGTGTGACTAATATTTTTAATTTTTTTTCATAAAATTTTCAAATAAGAC[A/G]
GACGGTTAAAACGTTGGACACGGATATCTATGGCTGCACTTATTTTGGGACGGAGGTAGTATTTGCTAGTTGTTTGTTATTGGAGATATTTAAATACATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	30.20%	0.63%	1.67%	NA
All Indica	2759	93.90%	2.40%	1.09%	2.65%	NA
All Japonica	1512	15.00%	84.90%	0.00%	0.13%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	97.50%	1.80%	0.50%	0.17%	NA
Indica II	465	85.20%	3.00%	1.29%	10.54%	NA
Indica III	913	95.80%	2.20%	1.31%	0.66%	NA
Indica Intermediate	786	94.10%	2.50%	1.15%	2.16%	NA
Temperate Japonica	767	25.70%	74.10%	0.00%	0.26%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	61.50%	37.50%	0.00%	1.04%	NA
Intermediate	90	60.00%	36.70%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103508890	T -> DEL	N	N	silent_mutation	Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0103508890	T -> C	LOC_Os01g07410.1	upstream_gene_variant ; 2945.0bp to feature; MODIFIER	silent_mutation	Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0103508890	T -> C	LOC_Os01g07390.1	downstream_gene_variant ; 4057.0bp to feature; MODIFIER	silent_mutation	Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0103508890	T -> C	LOC_Os01g07400.1	intron_variant ; MODIFIER	silent_mutation	Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0103508890	T -> C	LOC_Os01g07400.2	intron_variant ; MODIFIER	silent_mutation	Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103508890	NA	1.82E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890	1.56E-07	NA	mr1310	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890	NA	2.82E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890	1.21E-07	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890	NA	1.29E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890	NA	1.52E-24	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890	NA	1.15E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251