Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103472458:

Variant ID: vg0103472458 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3472458
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAAGACCCTCCTAAGGGGTTATATTCCCTCTTAGGCTACAAAAATTCCCAAATGATCGAGTATCATTTTCGTAAAAAAAAGTATTTTCATTTTCAACT[A/G]
CTCTTGATTTTAGTCATTTTTTTCCATTTTTATCGGTGCAAGTGGTTAGTAAATAATTAAATTGTCAAATATAAGAAATTCATGACCAATCCATAACCAC

Reverse complement sequence

GTGGTTATGGATTGGTCATGAATTTCTTATATTTGACAATTTAATTATTTACTAACCACTTGCACCGATAAAAATGGAAAAAAATGACTAAAATCAAGAG[T/C]
AGTTGAAAATGAAAATACTTTTTTTTACGAAAATGATACTCGATCATTTGGGAATTTTTGTAGCCTAAGAGGGAATATAACCCCTTAGGAGGGTCTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	31.40%	0.02%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.00%	0.00%	NA
All Japonica	1512	11.00%	88.90%	0.07%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	97.40%	2.60%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	16.60%	83.40%	0.00%	0.00%	NA
Tropical Japonica	504	4.80%	95.20%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	92.90%	0.41%	0.00%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103472458	A -> G	LOC_Os01g07340.1	upstream_gene_variant ; 4938.0bp to feature; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N
vg0103472458	A -> G	LOC_Os01g07350.1	upstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N
vg0103472458	A -> G	LOC_Os01g07360.1	downstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N
vg0103472458	A -> G	LOC_Os01g07360.3	downstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N
vg0103472458	A -> G	LOC_Os01g07360.4	downstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N
vg0103472458	A -> G	LOC_Os01g07360.2	downstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N
vg0103472458	A -> G	LOC_Os01g07350-LOC_Os01g07360	intergenic_region ; MODIFIER	silent_mutation	Average:72.491; most accessible tissue: Callus, score: 92.4	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103472458	NA	3.66E-19	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103472458	NA	3.07E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	2.29E-66	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	9.40E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	8.83E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	1.99E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	4.04E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	6.42E-51	mr1194	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	7.74E-13	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	4.26E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	2.05E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	2.92E-15	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	4.34E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	3.46E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	3.18E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	1.85E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	9.36E-22	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	1.43E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	6.89E-12	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	3.55E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	1.12E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	9.70E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	5.19E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	2.34E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	2.98E-23	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	3.73E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	5.92E-39	mr1882	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	5.06E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	5.04E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458	NA	1.57E-12	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251