Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103416985:

Variant ID: vg0103416985 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3416985
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCGATTTCGATTCCGAAAAAAAATATGAAAACGAAAACGATAAAGATGGTTTCCGTCCGTTTTCGTACCGTTTTCACCCCCTACATACATCTTACCAC[T/C]
ATGAGCATATCTAACTCTTCAAGAAATTAGAGTGACATATTTTAAGATCGGTGAGGTTATGATAAATGTTATTATTGTTAACATGCTGCTGAAAGAATAA

Reverse complement sequence

TTATTCTTTCAGCAGCATGTTAACAATAATAACATTTATCATAACCTCACCGATCTTAAAATATGTCACTCTAATTTCTTGAAGAGTTAGATATGCTCAT[A/G]
GTGGTAAGATGTATGTAGGGGGTGAAAACGGTACGAAAACGGACGGAAACCATCTTTATCGTTTTCGTTTTCATATTTTTTTTCGGAATCGAAATCGGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.80%	25.20%	12.36%	10.62%	NA
All Indica	2759	25.50%	40.20%	17.72%	16.56%	NA
All Japonica	1512	89.60%	3.60%	4.63%	2.18%	NA
Aus	269	95.50%	4.10%	0.37%	0.00%	NA
Indica I	595	6.10%	38.30%	21.85%	33.78%	NA
Indica II	465	9.00%	52.50%	21.29%	17.20%	NA
Indica III	913	44.40%	36.90%	11.72%	7.01%	NA
Indica Intermediate	786	28.00%	38.30%	19.47%	14.25%	NA
Temperate Japonica	767	83.70%	5.90%	7.04%	3.39%	NA
Tropical Japonica	504	96.40%	1.40%	1.39%	0.79%	NA
Japonica Intermediate	241	93.80%	1.20%	3.73%	1.24%	NA
VI/Aromatic	96	82.30%	3.10%	14.58%	0.00%	NA
Intermediate	90	63.30%	12.20%	11.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103416985	T -> DEL	N	N	silent_mutation	Average:28.058; most accessible tissue: Callus, score: 59.822	N	N	N	N
vg0103416985	T -> C	LOC_Os01g07240.1	upstream_gene_variant ; 999.0bp to feature; MODIFIER	silent_mutation	Average:28.058; most accessible tissue: Callus, score: 59.822	N	N	N	N
vg0103416985	T -> C	LOC_Os01g07240-LOC_Os01g07250	intergenic_region ; MODIFIER	silent_mutation	Average:28.058; most accessible tissue: Callus, score: 59.822	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103416985	NA	1.53E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	2.35E-18	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	8.55E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	7.54E-10	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	4.19E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	9.18E-16	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	9.95E-11	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	1.29E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	4.33E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	3.95E-09	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	8.95E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	1.75E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	8.41E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	1.85E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	4.31E-06	4.31E-06	mr1004_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	8.62E-06	mr1027_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	5.79E-14	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	6.17E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	9.84E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	1.17E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	8.80E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	1.04E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	6.82E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	6.17E-06	mr1239_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	5.11E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	6.21E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	3.81E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	3.99E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416985	NA	9.82E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251