Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103395450:

Variant ID: vg0103395450 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3395450
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAACAGCCGGGCCGTGCCGGCACGGGCCTGACAGCGATTGGGTTGTGCCGTGCTTAGGTCGGGCCAAAACCTCGTGCCTTGCGCCGGGCCGTCGGGCCT[C/T]
GGGCCTTATGGCCAACTATAGTCTCCCGTGACACCCCCCGGGGGCTCAACTCCCATTTTCTCGCGAATTCGCCCGCCGCCTGCGCCGATCTCCGGTGCTT

Reverse complement sequence

AAGCACCGGAGATCGGCGCAGGCGGCGGGCGAATTCGCGAGAAAATGGGAGTTGAGCCCCCGGGGGGTGTCACGGGAGACTATAGTTGGCCATAAGGCCC[G/A]
AGGCCCGACGGCCCGGCGCAAGGCACGAGGTTTTGGCCCGACCTAAGCACGGCACAACCCAATCGCTGTCAGGCCCGTGCCGGCACGGCCCGGCTGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	39.20%	0.57%	0.00%	NA
All Indica	2759	78.50%	21.20%	0.36%	0.00%	NA
All Japonica	1512	41.50%	58.50%	0.00%	0.00%	NA
Aus	269	3.70%	91.40%	4.83%	0.00%	NA
Indica I	595	96.50%	3.50%	0.00%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	59.40%	40.30%	0.33%	0.00%	NA
Indica Intermediate	786	78.20%	20.90%	0.89%	0.00%	NA
Temperate Japonica	767	23.20%	76.80%	0.00%	0.00%	NA
Tropical Japonica	504	70.80%	29.20%	0.00%	0.00%	NA
Japonica Intermediate	241	38.20%	61.80%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	46.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103395450	C -> T	LOC_Os01g07170.1	upstream_gene_variant ; 4694.0bp to feature; MODIFIER	silent_mutation	Average:91.554; most accessible tissue: Zhenshan97 flower, score: 94.524	N	N	N	N
vg0103395450	C -> T	LOC_Os01g07180.1	upstream_gene_variant ; 2439.0bp to feature; MODIFIER	silent_mutation	Average:91.554; most accessible tissue: Zhenshan97 flower, score: 94.524	N	N	N	N
vg0103395450	C -> T	LOC_Os01g07190.1	upstream_gene_variant ; 312.0bp to feature; MODIFIER	silent_mutation	Average:91.554; most accessible tissue: Zhenshan97 flower, score: 94.524	N	N	N	N
vg0103395450	C -> T	LOC_Os01g07200.1	upstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:91.554; most accessible tissue: Zhenshan97 flower, score: 94.524	N	N	N	N
vg0103395450	C -> T	LOC_Os01g07180-LOC_Os01g07190	intergenic_region ; MODIFIER	silent_mutation	Average:91.554; most accessible tissue: Zhenshan97 flower, score: 94.524	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0103395450	C	T	-0.01	0.0	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103395450	NA	2.09E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	3.10E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	3.73E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	8.51E-06	mr1102_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	1.48E-06	1.48E-06	mr1217_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	7.28E-06	mr1223_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	7.05E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	1.42E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	8.63E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	5.18E-06	NA	mr1607_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	6.65E-06	7.87E-07	mr1713_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	NA	1.37E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103395450	7.85E-06	7.85E-06	mr1852_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251