Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103381628:

Variant ID: vg0103381628 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3381628
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTTTGCCCACTACCTCTTCGTCTATGCCTAACTGCACCACCTTGAACTCTCTGGCCGGCGCGTGGAAGCCCATGACAGTGGCACAGTGAGGTCGGTGC[G/A]
ACCGGGGAAGATGCAGAATCTCACCTGTGGTAGGGTTGCACACGGAGTAGCCTTCGCACGGCCTGGCAATGAGGACGAGGCCCCAGCAGGGCTTGGAGCC

Reverse complement sequence

GGCTCCAAGCCCTGCTGGGGCCTCGTCCTCATTGCCAGGCCGTGCGAAGGCTACTCCGTGTGCAACCCTACCACAGGTGAGATTCTGCATCTTCCCCGGT[C/T]
GCACCGACCTCACTGTGCCACTGTCATGGGCTTCCACGCGCCGGCCAGAGAGTTCAAGGTGGTGCAGTTAGGCATAGACGAAGAGGTAGTGGGCAAACTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.70% 0.04% 0.00% NA
All Indica  2759 77.80% 22.20% 0.04% 0.00% NA
All Japonica  1512 41.50% 58.50% 0.00% 0.00% NA
Aus  269 3.70% 96.30% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 57.40% 42.60% 0.00% 0.00% NA
Indica Intermediate  786 78.20% 21.60% 0.13% 0.00% NA
Temperate Japonica  767 22.90% 77.10% 0.00% 0.00% NA
Tropical Japonica  504 71.40% 28.60% 0.00% 0.00% NA
Japonica Intermediate  241 38.20% 61.80% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103381628 G -> A LOC_Os01g07160.1 missense_variant ; p.Ser144Leu; MODERATE nonsynonymous_codon ; S144L Average:83.199; most accessible tissue: Zhenshan97 panicle, score: 92.533 unknown unknown TOLERATED 0.37

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103381628 G A -0.03 -0.03 -0.02 -0.04 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103381628 NA 7.96E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 5.16E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 3.10E-07 3.10E-07 mr1217_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 9.33E-06 mr1223_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 6.62E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 7.58E-06 7.58E-06 mr1228_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 7.86E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 6.60E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 6.13E-06 1.83E-06 mr1266_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 9.64E-06 mr1288_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 6.90E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 5.85E-06 5.85E-06 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 3.75E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 1.45E-06 1.45E-06 mr1365_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 8.84E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 5.90E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 3.30E-07 5.46E-06 mr1607_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 6.42E-06 6.42E-06 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 3.54E-06 3.54E-06 mr1710_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 6.37E-06 7.64E-07 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 2.95E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 2.01E-06 mr1740_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 9.42E-06 3.83E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 2.92E-06 mr1771_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 NA 4.40E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 1.13E-06 9.68E-07 mr1785_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 2.18E-07 1.86E-08 mr1800_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 9.76E-06 9.76E-06 mr1804_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 3.40E-06 1.58E-06 mr1837_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 1.35E-06 1.35E-06 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 2.19E-06 2.19E-06 mr1905_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103381628 9.61E-07 9.61E-07 mr1953_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251