Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102859069:

Variant ID: vg0102859069 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2859069
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TAACTCGAGGGAAGGAGATTGGGAGTTTACACGAGGGAATTGATAATGAGATTAAGATGGGAATTTGATTTTTAATCTCAATATCTTGTTTGGTAGAGGT[A/G]
ATGGAAATTGATAGGGAGTTTAGTTGGAGATTAAGTCATTAATAAAAACAGATGGCTCAGATTTGCTTAGAAAAAGTAAAGGAGGAATTCCCTCCCAATT

Reverse complement sequence

AATTGGGAGGGAATTCCTCCTTTACTTTTTCTAAGCAAATCTGAGCCATCTGTTTTTATTAATGACTTAATCTCCAACTAAACTCCCTATCAATTTCCAT[T/C]
ACCTCTACCAAACAAGATATTGAGATTAAAAATCAAATTCCCATCTTAATCTCATTATCAATTCCCTCGTGTAAACTCCCAATCTCCTTCCCTCGAGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	48.30%	0.08%	0.42%	NA
All Indica	2759	32.30%	67.10%	0.07%	0.58%	NA
All Japonica	1512	76.50%	23.40%	0.00%	0.07%	NA
Aus	269	86.20%	13.80%	0.00%	0.00%	NA
Indica I	595	11.10%	88.70%	0.00%	0.17%	NA
Indica II	465	13.30%	86.00%	0.00%	0.65%	NA
Indica III	913	54.20%	45.00%	0.22%	0.55%	NA
Indica Intermediate	786	34.10%	65.00%	0.00%	0.89%	NA
Temperate Japonica	767	79.90%	20.10%	0.00%	0.00%	NA
Tropical Japonica	504	74.80%	25.00%	0.00%	0.20%	NA
Japonica Intermediate	241	69.30%	30.70%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	53.30%	41.10%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102859069	A -> G	LOC_Os01g05970.1	upstream_gene_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587	N	N	N	N
vg0102859069	A -> G	LOC_Os01g05980.1	downstream_gene_variant ; 3844.0bp to feature; MODIFIER	silent_mutation	Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587	N	N	N	N
vg0102859069	A -> G	LOC_Os01g06000.1	downstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587	N	N	N	N
vg0102859069	A -> G	LOC_Os01g05970-LOC_Os01g06000	intergenic_region ; MODIFIER	silent_mutation	Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587	N	N	N	N
vg0102859069	A -> DEL	N	N	silent_mutation	Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102859069	NA	6.28E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069	NA	2.57E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069	NA	5.46E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069	NA	1.47E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069	1.18E-06	6.76E-07	mr1347	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069	NA	2.37E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251