RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0102728977:

Variant ID: vg0102728977 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2728977
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTAATCTGGATTGTAGAGCATACTGATATGTTCAATGCCTAGATGACAAAACTTCAACATGGGCTACCGCATTCTATTATTATTATTTTTAAAATTGTAC[T/A]
ACAAAAGAAAGGGACTAAAAAGGATTTCTGATTGAGCCTAAAAGGCTAATTACCATCTGGTAGCTCTTCATTGTTAGGCGGCCTAAGGTTTACTACCTTG

Reverse complement sequence

CAAGGTAGTAAACCTTAGGCCGCCTAACAATGAAGAGCTACCAGATGGTAATTAGCCTTTTAGGCTCAATCAGAAATCCTTTTTAGTCCCTTTCTTTTGT[A/T]
GTACAATTTTAAAAATAATAATAATAGAATGCGGTAGCCCATGTTGAAGTTTTGTCATCTAGGCATTGAACATATCAGTATGCTCTACAATCCAGATTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	12.70%	0.02%	0.00%	NA
All Indica	2759	79.30%	20.60%	0.04%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	69.50%	30.50%	0.00%	0.00%	NA
Indica III	913	74.50%	25.40%	0.11%	0.00%	NA
Indica Intermediate	786	77.40%	22.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102728977	T -> A	LOC_Os01g05710.1	downstream_gene_variant ; 4180.0bp to feature; MODIFIER	silent_mutation	Average:49.958; most accessible tissue: Callus, score: 69.853	N	N	N	N
vg0102728977	T -> A	LOC_Os01g05720.1	intron_variant ; MODIFIER	silent_mutation	Average:49.958; most accessible tissue: Callus, score: 69.853	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102728977	NA	3.70E-08	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102728977	NA	1.75E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102728977	NA	3.03E-07	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102728977	4.16E-07	5.91E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102728977	NA	1.02E-07	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102728977	3.23E-07	6.58E-10	mr1951_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0102728977:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact