Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102388565:

Variant ID: vg0102388565 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2388565
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATTTCTAATTTGAACCTACCTGTGTGTTCTTTTTGTGCTAATCACGGCATGGTTATGTCCAGAATAAATAAGACAAGAATGTGAGGGCTAGTTGCTC[G/T,A]
TTCAAAGAAATATATATACTTCTTTCCAGAGTAATTGTAGTTCTGCAGTTGGAGGATTTTTGTTTTCTTTCAATATTTCTGTACTGCCTACATTGTGGAA

Reverse complement sequence

TTCCACAATGTAGGCAGTACAGAAATATTGAAAGAAAACAAAAATCCTCCAACTGCAGAACTACAATTACTCTGGAAAGAAGTATATATATTTCTTTGAA[C/A,T]
GAGCAACTAGCCCTCACATTCTTGTCTTATTTATTCTGGACATAACCATGCCGTGATTAGCACAAAAAGAACACACAGGTAGGTTCAAATTAGAAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	8.40%	0.11%	0.00%	A: 0.63%
All Indica	2759	98.40%	0.50%	0.00%	0.00%	A: 1.01%
All Japonica	1512	75.70%	24.10%	0.20%	0.00%	NA
Aus	269	99.30%	0.00%	0.00%	0.00%	A: 0.74%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	97.20%	0.10%	0.00%	0.00%	A: 2.74%
Indica Intermediate	786	98.30%	1.30%	0.00%	0.00%	A: 0.38%
Temperate Japonica	767	96.90%	3.10%	0.00%	0.00%	NA
Tropical Japonica	504	40.90%	58.90%	0.20%	0.00%	NA
Japonica Intermediate	241	80.90%	18.30%	0.83%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102388565	G -> T	LOC_Os01g05090.1	3_prime_UTR_variant ; 276.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> T	LOC_Os01g05100.1	3_prime_UTR_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> T	LOC_Os01g05080.1	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> T	LOC_Os01g05105.1	upstream_gene_variant ; 4915.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> T	LOC_Os01g05080.2	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> A	LOC_Os01g05090.1	3_prime_UTR_variant ; 276.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> A	LOC_Os01g05100.1	3_prime_UTR_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> A	LOC_Os01g05080.1	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> A	LOC_Os01g05105.1	upstream_gene_variant ; 4915.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N
vg0102388565	G -> A	LOC_Os01g05080.2	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102388565	NA	3.55E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	NA	2.21E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	5.10E-07	1.40E-14	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	1.72E-06	1.49E-19	mr1769	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	NA	6.07E-06	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	NA	1.12E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	NA	7.01E-09	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	NA	9.47E-08	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	1.02E-08	2.42E-18	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565	8.76E-08	5.19E-21	mr1769_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251