Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102349632:

Variant ID: vg0102349632 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2349632
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTATGAGTAATATATTCCCCCTTCCCGCAAAAAAAAGAAAAAAAAGAAAAAAGAAGGTTCATGCGGCCACAAGTTGAACAGAGGTGTTACTTGTAT[T/C]
GAAGCCTTGGCCGGGCTGCTCCAGGGAGAAGGAAGCCAACTTTTCAAAACAACATGTCATGTCGGGATTTCCTGTGGTTTCTAATTTAAAAAGGTAGCCC

Reverse complement sequence

GGGCTACCTTTTTAAATTAGAAACCACAGGAAATCCCGACATGACATGTTGTTTTGAAAAGTTGGCTTCCTTCTCCCTGGAGCAGCCCGGCCAAGGCTTC[A/G]
ATACAAGTAACACCTCTGTTCAACTTGTGGCCGCATGAACCTTCTTTTTTCTTTTTTTTCTTTTTTTTGCGGGAAGGGGGAATATATTACTCATAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.40%	0.51%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	79.60%	19.00%	1.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	67.90%	29.30%	2.74%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	75.90%	23.70%	0.41%	0.00%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102349632	T -> C	LOC_Os01g04990.1	downstream_gene_variant ; 287.0bp to feature; MODIFIER	silent_mutation	Average:63.012; most accessible tissue: Zhenshan97 root, score: 84.911	N	N	N	N
vg0102349632	T -> C	LOC_Os01g04990.2	downstream_gene_variant ; 287.0bp to feature; MODIFIER	silent_mutation	Average:63.012; most accessible tissue: Zhenshan97 root, score: 84.911	N	N	N	N
vg0102349632	T -> C	LOC_Os01g04980-LOC_Os01g04990	intergenic_region ; MODIFIER	silent_mutation	Average:63.012; most accessible tissue: Zhenshan97 root, score: 84.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102349632	NA	4.40E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102349632	NA	6.29E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102349632	NA	1.85E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	4.63E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	2.96E-09	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	4.16E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	1.88E-06	7.92E-13	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	1.24E-07	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	9.91E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	1.12E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	2.83E-08	4.51E-19	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	8.19E-08	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	4.72E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	8.72E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	7.84E-18	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	2.56E-08	3.12E-23	mr1902_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632	NA	1.55E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251