Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102009968:

Variant ID: vg0102009968 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2009968
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCTCCGTCGCCGCTGACTGGTGTCCTTGCCTATACGATTGGTTGGTCACACTACCGTTCATGGGCATCCACGTCTTCACCGACCGGCTGGCCTTTGCC[G/A]
CCGCTGACTGGTGTTTTCGCCTGCACGGCTGGCCTATTATGCCGCCGCTGTTGGGCGTCTACGACTTCACCGCCGGCCTGCCTCCGTCGCCGCCGACTGG

Reverse complement sequence

CCAGTCGGCGGCGACGGAGGCAGGCCGGCGGTGAAGTCGTAGACGCCCAACAGCGGCGGCATAATAGGCCAGCCGTGCAGGCGAAAACACCAGTCAGCGG[C/T]
GGCAAAGGCCAGCCGGTCGGTGAAGACGTGGATGCCCATGAACGGTAGTGTGACCAACCAATCGTATAGGCAAGGACACCAGTCAGCGGCGACGGAGGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.70%	14.60%	32.73%	23.00%	NA
All Indica	2759	10.50%	23.50%	45.99%	19.97%	NA
All Japonica	1512	53.40%	0.50%	11.51%	34.52%	NA
Aus	269	74.70%	7.40%	17.47%	0.37%	NA
Indica I	595	5.70%	6.90%	53.78%	33.61%	NA
Indica II	465	25.80%	25.60%	34.19%	14.41%	NA
Indica III	913	6.70%	27.10%	50.82%	15.44%	NA
Indica Intermediate	786	9.70%	30.70%	41.48%	18.19%	NA
Temperate Japonica	767	65.60%	0.70%	8.60%	25.16%	NA
Tropical Japonica	504	38.90%	0.60%	14.68%	45.83%	NA
Japonica Intermediate	241	45.20%	0.00%	14.11%	40.66%	NA
VI/Aromatic	96	70.80%	2.10%	26.04%	1.04%	NA
Intermediate	90	40.00%	11.10%	35.56%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102009968	G -> A	LOC_Os01g04510.1	upstream_gene_variant ; 2714.0bp to feature; MODIFIER	silent_mutation	Average:21.527; most accessible tissue: Callus, score: 31.728	N	N	N	N
vg0102009968	G -> A	LOC_Os01g04520.1	upstream_gene_variant ; 4853.0bp to feature; MODIFIER	silent_mutation	Average:21.527; most accessible tissue: Callus, score: 31.728	N	N	N	N
vg0102009968	G -> A	LOC_Os01g04510-LOC_Os01g04520	intergenic_region ; MODIFIER	silent_mutation	Average:21.527; most accessible tissue: Callus, score: 31.728	N	N	N	N
vg0102009968	G -> DEL	N	N	silent_mutation	Average:21.527; most accessible tissue: Callus, score: 31.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102009968	NA	6.34E-07	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102009968	NA	8.67E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102009968	NA	2.78E-06	mr1680	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102009968	NA	6.97E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102009968	2.80E-06	NA	mr1847	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102009968	NA	1.76E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251